Jatropha Genome Database

JcCB0641211.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0641211.20 - phase: 0 /partial
         (297 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29983.m003235 o-methyltransferase, putative                           242   1e-63
29983.m003236 o-methyltransferase, putative                            84   5e-16
30131.m007199 o-methyltransferase, putative                            70   8e-12

>29983.m003235 o-methyltransferase, putative
          Length = 1059

 Score =  242 bits (122), Expect = 1e-63
 Identities = 251/294 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1    tggataatgcatgattggggagatgacgattgcgtaaagatattgaagaattgccggaaa 60
            |||||||||||||||||||||||||| ||||| || | |||||| || |||||| |||||
Sbjct: 760  tggataatgcatgattggggagatgaagattgtgtcaggatattaaaaaattgcaggaaa 819

                                                                        
Query: 61   gccataccggagaagaaagggaaggttattatcgttgatatagttttgaaaccagagggt 120
            || ||||||||||||| |||||||||||| || |||||||||||  || | |||||||||
Sbjct: 820  gcaataccggagaagacagggaaggttatgattgttgatatagtgctgcagccagagggt 879

                                                                        
Query: 121  aatgacctgtttgatgatactggtttggtttttgatctgttaatgattgcacattcttct 180
            |||| ||| |||||||| ||  | ||||| |||||| || |||||||||||||||| || 
Sbjct: 880  aatggcctatttgatgacacaaggttggtgtttgatttgctaatgattgcacattcctca 939

                                                                        
Query: 181  ggtggaaaggaaagaactgaggctgaatggaaaatattgttggaagaaggaggcttccct 240
            ||||||||||| |||||||| || |||||||| | | | ||||| |||||||||||||||
Sbjct: 940  ggtggaaaggagagaactgaagccgaatggaagaaaatattggaggaaggaggcttccct 999

                                                                  
Query: 241  cgttacaatattatcaagattccagctttaacttccattattgaggcctttcct 294
            ||||| |  |||||||| || |||||||| || ||||| |||||||||| ||||
Sbjct: 1000 cgttatagaattatcaaaatcccagctttgacatccatcattgaggcctatcct 1053


>29983.m003236 o-methyltransferase, putative
          Length = 1056

 Score = 83.8 bits (42), Expect = 5e-16
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   tggataatgcatgattggggagatgacgattgcgtaaagatattgaagaattgccggaaa 60
           |||||| |||||||||||||||||||  |||| ||||| || ||||||||||||||||||
Sbjct: 757 tggatattgcatgattggggagatgaatattgtgtaaaaattttgaagaattgccggaaa 816

                         
Query: 61  gccataccggagaa 74
           || ||||| |||||
Sbjct: 817 gcaatacctgagaa 830


>30131.m007199 o-methyltransferase, putative
          Length = 1083

 Score = 69.9 bits (35), Expect = 8e-12
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 205  gaatggaaaatattgttggaagaaggaggcttccctcgttacaatattatcaagattcca 264
            |||||| ||||||| ||| | |||||||||||   ||||||||| |||||||| ||||||
Sbjct: 988  gaatgggaaatattattgaaggaaggaggctttggtcgttacaagattatcaaaattcca 1047

                                   
Query: 265  gctttaacttccattattgaggc 287
            |||||| | || |||||||||||
Sbjct: 1048 gctttagcatcaattattgaggc 1070