Jatropha Genome Database

JcCB0631101.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0631101.10 + phase: 0 /pseudo
         (387 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m013900 nucleic acid binding protein, putative                  119   1e-26

>30147.m013900 nucleic acid binding protein, putative
          Length = 1254

 Score =  119 bits (60), Expect = 1e-26
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 190 cagctctacttccactccagaagtggcatttaccatgaccctaatggtggctggtactat 249
           ||||||||||||||| |||| |||||  |||| |||||||||| || ||| ||||| | |
Sbjct: 76  cagctctacttccacgccagcagtggattttatcatgaccctagtgctggttggtatttt 135

                                                       
Query: 250 agtagtagagatgggctttattacaagtttgagaatggaagtta 293
           |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 136 agtagtagagatggactttattacaagtttgagaatggaagtta 179