Jatropha Genome Database

JcCB0625131.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0625131.10 - phase: 0 /partial
         (324 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29929.m004562 cytochrome P450, putative                                68   3e-11
29629.m001350 cytochrome P450, putative                                56   1e-07
30169.m006285 cytochrome P450, putative                                54   5e-07
29910.m000943 cytochrome P450, putative                                50   8e-06
28073.m000032 cytochrome P450, putative                                50   8e-06

>29929.m004562 cytochrome P450, putative
          Length = 1575

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 94/114 (82%)
 Strand = Plus / Plus

                                                                        
Query: 100  gagtttcttccatttggtgccgggaggagagtttgtcctggaatattattcggcatatct 159
            |||||||| |||||||| |  || |||||  | ||||||||||||| ||| || ||  ||
Sbjct: 1348 gagtttctaccatttggaggtggaaggaggatgtgtcctggaatatcatttggtatggct 1407

                                                                  
Query: 160  aatgttcaatttcctcttgcccgattgctatatcattttgattggaaacttcct 213
            |  ||| || |||| ||||||||| ||||||| |||||||||||||||||||||
Sbjct: 1408 acggttgaacttccacttgcccgaatgctataccattttgattggaaacttcct 1461


>29629.m001350 cytochrome P450, putative
          Length = 1500

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 109/136 (80%)
 Strand = Plus / Plus

                                                                        
Query: 109  ccatttggtgccgggaggagagtttgtcctggaatattattcggcatatctaatgttcaa 168
            ||||||||||| || |||||| | ||||||||||| || || || ||  |||||||| | 
Sbjct: 1297 ccatttggtgcaggaaggagaatgtgtcctggaattttgtttggtatggctaatgttgag 1356

                                                                        
Query: 169  tttcctcttgcccgattgctatatcattttgattggaaacttcctaatggaatgcagcca 228
             |||| || || | ||| || || ||||||||||||||||||||| ||||| || || ||
Sbjct: 1357 cttccactagcacaatttctttaccattttgattggaaacttcctgatggactggaggca 1416

                            
Query: 229  gaagatcttgacatga 244
            |||  |||||| ||||
Sbjct: 1417 gaaagtcttgatatga 1432


>30169.m006285 cytochrome P450, putative
          Length = 1602

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 187  ctatatcattttgattggaaacttcctaatggaat 221
            |||||||||||||| |||||||||||| |||||||
Sbjct: 1471 ctatatcattttgactggaaacttcctgatggaat 1505


>29910.m000943 cytochrome P450, putative
          Length = 1524

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 194  attttgattggaaacttcctaatggaatgcagccagaagat 234
            |||||||||||||||| ||| |||||||| |||| ||||||
Sbjct: 1388 attttgattggaaactccctgatggaatgaagccggaagat 1428


>28073.m000032 cytochrome P450, putative
          Length = 624

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 184 ttgctatatcattttgattggaaacttcctaatggaatgcagccagaagatcttgacatg 243
           |||||||| || |||||||||||||||||  | ||| || |||| ||| |||||||||||
Sbjct: 481 ttgctataccactttgattggaaacttccatacggactgaagcctgaaaatcttgacatg 540

            
Query: 244 a 244
           |
Sbjct: 541 a 541