Jatropha Genome Database

JcCB0611761.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0611761.10 - phase: 0 /partial
         (243 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m009165 conserved hypothetical protein                          212   7e-55

>30174.m009165 conserved hypothetical protein
          Length = 1014

 Score =  212 bits (107), Expect = 7e-55
 Identities = 158/175 (90%)
 Strand = Plus / Plus

                                                                       
Query: 65  ctgaaatttcctgtgatgtggataattttgaagaccaaaccttgttggattctagcagtt 124
           |||||||||| |||||||||||||||||| |||| ||||| |  ||||||||| ||||||
Sbjct: 209 ctgaaatttcatgtgatgtggataattttcaagagcaaacttccttggattcttgcagtt 268

                                                                       
Query: 125 ttgttgttgttcatggagcaggttcttttgggcattttcaggctagcaaatcgggggttc 184
           ||||||||||||| ||||||||||| ||||| || || |||||||||||||| |||||||
Sbjct: 269 ttgttgttgttcacggagcaggttcgtttggacacttccaggctagcaaatcaggggttc 328

                                                                  
Query: 185 ataagggaggattggaccaaccacttgtcagggctggttttgttgctacacgcat 239
           ||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||
Sbjct: 329 ataagggaggattgagccaaccacttgtcaaggctggttttgttgccacacgcat 383