Jatropha Genome Database

JcCB0603701.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0603701.10 - phase: 0 /partial
         (408 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30204.m001780 conserved hypothetical protein                          178   2e-44

>30204.m001780 conserved hypothetical protein
          Length = 876

 Score =  178 bits (90), Expect = 2e-44
 Identities = 326/404 (80%), Gaps = 3/404 (0%)
 Strand = Plus / Plus

                                                                       
Query: 7   ttgggctgggcctatatgcagaaatcaaactttttggcagcagaagcggtgtatcagaaa 66
           ||||| |||||||| ||||| |||||||||||  ||||||||||||  |||||| | |||
Sbjct: 469 ttgggatgggcctacatgcaaaaatcaaacttcatggcagcagaagtagtgtataaaaaa 528

                                                                       
Query: 67  gcccaaatgatcgacccggacgcgaacaaagcttgcaacttgggcctttgtcttataaag 126
           ||||||||||| ||||| || ||||| || || | ||| |||||| ||||||| |||| |
Sbjct: 529 gcccaaatgattgaccccgatgcgaataaggcctacaatttgggcttttgtctgataagg 588

                                                                       
Query: 127 caagcccgattcgatgaggcccagtttgttctccaaaacgtgatggaaggaagatatcct 186
           |||||||||| |||||||||||      |||| ||||| ||  ||||||| ||||  || 
Sbjct: 589 caagcccgatacgatgaggcccgacagattcttcaaaatgtattggaaggtagattcccg 648

                                                                       
Query: 187 ggttcagaagatatcaagtcaataaaaagagctcaagaattgttaagggaagtggaaaca 246
           |||||| | |||   || |||| |||||||||||| |||||||||| |||| ||||| ||
Sbjct: 649 ggttcaaatgattgtaaatcaagaaaaagagctcaggaattgttaatggaaatggaatca 708

                                                                       
Query: 247 aaaatgccttcacctgagctaacaggtatattagggtttaatcttgat---gatcatgat 303
           ||  ||||| ||||||| ||||||  || | | ||| ||||| | |||   ||| |||||
Sbjct: 709 aagttgcctccacctgaactaacaaatagaattgggattaatgtcgatggcgatgatgat 768

                                                                       
Query: 304 tttgttaaagggcttgaggaaatgatggaagaatgggcaccagcaagatcaaagagactt 363
           |||||||||||| ||||| |||||||| |  ||||||| ||| | ||| |||| || |||
Sbjct: 769 tttgttaaagggattgagcaaatgatgaataaatgggctccatctagaccaaaaaggctt 828

                                                       
Query: 364 cccatatttgaacagatctcttcatttagagatcaattagcatg 407
           || || |||||| | ||||||||||| |||||||||||||||||
Sbjct: 829 ccaatctttgaagaaatctcttcattgagagatcaattagcatg 872