Jatropha Genome Database
- JcCB0597261.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0597261.20 + phase: 0 /partial
(248 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27894.m000784 similarity to rab3 gtpase-activating protein non-c... 198 1e-50
>27894.m000784 similarity to rab3 gtpase-activating protein
non-catalitic subunit, putative
Length = 1455
Score = 198 bits (100), Expect = 1e-50
Identities = 211/248 (85%)
Strand = Plus / Plus
Query: 1 atgtcgtctaagcgaaatcacacgacggagctgggatgcatagcgtgcgaggagctgagc 60
||||| || ||| ||| |||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1 atgtcatcgaagagaagtcacacgacggagctggggtgcatagcgtgcgaggagctgagc 60
Query: 61 gacgttggcgcaggaaaggaaggttggctggtggataacccgagtcttctatgcgcgctt 120
|| || || || ||||||||||||||||| || || ||||| | ||| |||||| |||
Sbjct: 61 gatgtaggagctggaaaggaaggttggcttgttgacaacccaaaccttaaatgcgctctt 120
Query: 121 gacacccactctatcgctctcgcaaatcgttctctcatcttaatcaccggatgggacgat 180
|||||||| || ||||| | ||||||| | |||||| |||||||| || |||||||||
Sbjct: 121 gacacccattccatcgccatttcaaatcgctatctcattttaatcactggttgggacgat 180
Query: 181 gggccccgcctcaagatccgacccaatttatctcccatcgagtctgaatctatcaccgca 240
|||||||| ||||||||||||||| ||||||| |||||||| || ||||| ||||||||
Sbjct: 181 gggccccgtctcaagatccgacccgatttatcccccatcgaatccgaatccatcaccgcc 240
Query: 241 ttggagtg 248
|||||||
Sbjct: 241 ctggagtg 248