Jatropha Genome Database

JcCB0597261.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0597261.10 - phase: 0 /partial
         (541 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27894.m000780 conserved hypothetical protein                          129   2e-29

>27894.m000780 conserved hypothetical protein
          Length = 1698

 Score =  129 bits (65), Expect = 2e-29
 Identities = 224/277 (80%)
 Strand = Plus / Plus

                                                                       
Query: 263 tcttttaccggataaaaaacccgcataagatccatgccgataacttcacagaggaggagc 322
           ||||||||||| ||||||||||  | |||| | | || ||||||||  | || || ||||
Sbjct: 239 tcttttaccggctaaaaaaccccaacaagaactacgctgataacttatcggaagatgagc 298

                                                                       
Query: 323 tcaacttaattggtcttgggtacgatcggatggtccgtttcatggagaaagacgacccaa 382
           | |||||||||||||| || || || || |||||| | |||||||||||||| ||||| |
Sbjct: 299 ttaacttaattggtctaggttatgaccgaatggtcaggttcatggagaaagatgacccca 358

                                                                       
Query: 383 atctcaaacatccatacgattggtacaagtatggtgagtttggaccgtactcatggcgcg 442
           || |||| ||||| || ||||||||||| || || |||||||| ||||| || ||||| |
Sbjct: 359 atatcaagcatccctatgattggtacaaatacggagagtttgggccgtattcgtggcgtg 418

                                                                       
Query: 443 gagtggttcttggggatccaatagcaggtcgttttactgatgagcgcgttacgctgtaca 502
           | |||||  ||||||| ||| | |  |||||||||||||||||  | || ||  ||||||
Sbjct: 419 gcgtggtaattggggacccagtcgtgggtcgttttactgatgacagagtgactttgtaca 478

                                                
Query: 503 gcgaagttaaagaccaggaagagtgggagaagattga 539
           | ||||| ||||| |||||||| ||||| ||||||||
Sbjct: 479 gtgaagtaaaagatcaggaagaatgggaaaagattga 515