Jatropha Genome Database

JcCB0590911.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0590911.10 - phase: 0 /partial
         (182 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m006983 conserved hypothetical protein                          103   3e-22

>30131.m006983 conserved hypothetical protein
          Length = 2241

 Score =  103 bits (52), Expect = 3e-22
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    gttgacggtcagcaccttattcttcatcctttaaacatgaagtgtcttctacaccattat 63
            ||||| |||||||| || |||||||| ||  ||||||||||||||||||| || || |||
Sbjct: 1483 gttgatggtcagcatctcattcttcaccccctaaacatgaagtgtcttctgcaacactat 1542

                                                                        
Query: 64   gggagctatgatatgcttcctcagaggataaacggaacaattttgcagttggaaacagtg 123
            |||||||||||||||||||| || || ||||  |||| ||| |||||||||||   ||| 
Sbjct: 1543 gggagctatgatatgcttccgcacagaataagtggaaaaatcttgcagttggaggtagta 1602

                                            
Query: 124  actcagtcagaagcaatgagaaggcgatatcg 155
            |||||||| || || ||||| ||||| |||||
Sbjct: 1603 actcagtcggaggccatgaggaggcgctatcg 1634