Jatropha Genome Database
- JcCB0587121.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0587121.10 - phase: 2 /pseudo/partial
(781 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30174.m008721 conserved hypothetical protein 127 1e-28
29738.m001041 conserved hypothetical protein 86 4e-16
>30174.m008721 conserved hypothetical protein
Length = 948
Score = 127 bits (64), Expect = 1e-28
Identities = 100/112 (89%)
Strand = Plus / Plus
Query: 1 agctcaaggaccaagagaccgcagaatgagattgtctctaaaagttgctcgagaattctt 60
|||||| || ||||||||||| |||||||||||||| || ||||||||||| ||||||||
Sbjct: 150 agctcaggggccaagagaccggagaatgagattgtcacttaaagttgctcgtgaattctt 209
Query: 61 tgatctacaagacaagttatgttttgataaagcaagcaaaactgttgagtgg 112
|||||| ||||||||| | || ||||||||||| |||||||| |||||||||
Sbjct: 210 tgatctgcaagacaagctttgctttgataaagctagcaaaaccgttgagtgg 261
>29738.m001041 conserved hypothetical protein
Length = 1350
Score = 85.7 bits (43), Expect = 4e-16
Identities = 97/115 (84%)
Strand = Plus / Plus
Query: 1 agctcaaggaccaagagaccgcagaatgagattgtctctaaaagttgctcgagaattctt 60
||||||||| ||||||||| | |||||||| |||||||| || ||||| | | |||||
Sbjct: 405 agctcaagggccaagagacaggagaatgaggttgtctcttcaaattgctaggaagttctt 464
Query: 61 tgatctacaagacaagttatgttttgataaagcaagcaaaactgttgagtggcta 115
|||||||||||||| |||| | || ||||||||||||||||| |||| ||||||
Sbjct: 465 tgatctacaagacatgttaggcttcgataaagcaagcaaaacaattgactggcta 519