Jatropha Genome Database

JcCB0580021.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0580021.20 - phase: 1 /partial
         (203 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29646.m001077 ketol-acid reductoisomerase, chloroplast precursor...   165   1e-40
29900.m001612 ketol-acid reductoisomerase, chloroplast precursor...    50   5e-06

>29646.m001077 ketol-acid reductoisomerase, chloroplast precursor,
            putative
          Length = 1755

 Score =  165 bits (83), Expect = 1e-40
 Identities = 173/203 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1    ctcgttttgattatatccttacccagcaagcttttgtagctgtggacaatggtgctcctg 60
            |||||||||| |||||||| || ||||||||| | ||| | |||||||||||| |||| |
Sbjct: 1550 ctcgttttgactatatcctcacacagcaagctatggtatcagtggacaatggtactcccg 1609

                                                                        
Query: 61   taaatcgtgatctcatcagcaacttcctatcagacccagtgcatggagccattgaggttt 120
            | ||  ||||||| |||||||||||| | ||||| ||||||||||| ||||| ||||| |
Sbjct: 1610 tcaaatgtgatcttatcagcaacttcatgtcagatccagtgcatggtgccatagaggtat 1669

                                                                        
Query: 121  gtgcccaattaagacctactttggacatttcagtgccaccggatgccgactttgtgagac 180
            | |||||||| ||||||||  | ||||| ||||| || || |||||||||||||||||||
Sbjct: 1670 gcgcccaattgagacctacagttgacatctcagttcccccagatgccgactttgtgagac 1729

                                   
Query: 181  cagagttgcgccaatctagcaat 203
            | || ||||||||||||||||||
Sbjct: 1730 ctgaattgcgccaatctagcaat 1752


>29900.m001612 ketol-acid reductoisomerase, chloroplast precursor,
            putative
          Length = 1785

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 6    tttgattatatccttacccagcaagcttttgtagctgtgga 46
            |||||||| || |||||||| ||||| ||||||||||||||
Sbjct: 1585 tttgattacattcttacccaacaagcctttgtagctgtgga 1625