Jatropha Genome Database

JcCB0577381.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0577381.10 + phase: 0 /pseudo/partial
         (332 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30093.m000358 ATP phosphoribosyltransferase, putative                  92   2e-18

>30093.m000358 ATP phosphoribosyltransferase, putative
          Length = 480

 Score = 91.7 bits (46), Expect = 2e-18
 Identities = 103/117 (88%), Gaps = 5/117 (4%)
 Strand = Plus / Plus

                                                                       
Query: 15  cagctttccaacgtggaagtctggttcctagcgacctaaagtacattgtagtcgaaaatt 74
           ||||| |||||| | ||||| ||||||| ||||||| |||| ||||||||  || || ||
Sbjct: 346 cagctctccaacttagaagtgtggttcc-agcgacccaaag-acattgta--cggaagtt 401

                                                                    
Query: 75  gttatcaggagatttggaccttggaattgt-ggttttgatacagtcaatgaatatgg 130
           |||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||
Sbjct: 402 gttatctggagatttggaccttggaattgtgggttttgatacagtcagtgaatatgg 458