Jatropha Genome Database
- JcCB0568851.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0568851.10 - phase: 0 /partial
(1026 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27810.m000633 nucleic acid binding protein, putative 74 2e-12
27810.m000634 nucleic acid binding protein, putative 56 4e-07
>27810.m000633 nucleic acid binding protein, putative
Length = 2178
Score = 73.8 bits (37), Expect = 2e-12
Identities = 147/184 (79%), Gaps = 6/184 (3%)
Strand = Plus / Plus
Query: 316 aatcgttctggtcgttctaaaacactaactccttcaaacctcgaagaactcttttctgct 375
|||||||||||||||| || | ||||||||||||||||| || || || |||| |||
Sbjct: 1471 aatcgttctggtcgtttaaagattctaactccttcaaaccttgatgatctgttttttgcg 1530
Query: 376 gagatctcttctcctcgatactctgatcaagca------gctgcagtgttctctcctaca 429
|||| |||||||||||| || ||||||||||| | ||||| ||||| || |
Sbjct: 1531 gagagctcttctcctcggtatgctgatcaagcattggcctcagcagttttctcgccaagc 1590
Query: 430 cataaatcagctgttctcaatcaattccagcagcagcagagcatgttatctccaatcaat 489
|| || || || ||||| ||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 1591 cacaagtctgcagttctgaatcaattccagcagcagcagagtatgttgtcaccaatcaac 1650
Query: 490 acaa 493
||||
Sbjct: 1651 acaa 1654
Score = 69.9 bits (35), Expect = 3e-11
Identities = 70/81 (86%), Gaps = 3/81 (3%)
Strand = Plus / Plus
Query: 808 tcatttgagcttggtaacaatggggaggagccagacctgtcatgggtccaatctctggtt 867
||||||||||||||||| ||| |||||||| || || |||||||||||||| || |||
Sbjct: 1948 tcatttgagcttggtaa---tggagaggagcctgatctatcatgggtccaatcacttgtt 2004
Query: 868 aaagaatcacctcctgagatg 888
|||||||| ||| ||||||||
Sbjct: 2005 aaagaatctcctactgagatg 2025
>27810.m000634 nucleic acid binding protein, putative
Length = 2187
Score = 56.0 bits (28), Expect = 4e-07
Identities = 46/52 (88%)
Strand = Plus / Plus
Query: 442 gttctcaatcaattccagcagcagcagagcatgttatctccaatcaatacaa 493
||||||||||| ||||| |||||||| || |||||||| |||||||| ||||
Sbjct: 1606 gttctcaatcagttccaacagcagcaaagtatgttatcaccaatcaacacaa 1657
Score = 54.0 bits (27), Expect = 2e-06
Identities = 65/77 (84%), Gaps = 3/77 (3%)
Strand = Plus / Plus
Query: 808 tcatttgagcttggtaacaatggggaggagccagacctgtcatgggtccaatctctggtt 867
||||||||||||||||| |||||||||||| || || || ||||| ||||| || |||
Sbjct: 1951 tcatttgagcttggtaa---tggggaggagcctgatctatcgtgggtgcaatcacttgtt 2007
Query: 868 aaagaatcacctcctga 884
|||||||| ||| ||||
Sbjct: 2008 aaagaatctcctactga 2024