Jatropha Genome Database

JcCB0551471.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0551471.10 - phase: 0 /partial
         (454 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29942.m000735 lipid binding protein, putative                         103   9e-22

>29942.m000735 lipid binding protein, putative
          Length = 636

 Score =  103 bits (52), Expect = 9e-22
 Identities = 121/144 (84%)
 Strand = Plus / Plus

                                                                       
Query: 244 gttccggacaagaattgctgcccggaattggctggattggtggatagtaatcctatatgt 303
           ||||| || |||||||||||||||||  | || |||||| ||||| |||| |||||||||
Sbjct: 247 gttcctgataagaattgctgcccggagctagccggattgttggatggtaaccctatatgt 306

                                                                       
Query: 304 ttgtgtcagttgctagggaatagtagcttgacggagtcttttggtataaagattaatatt 363
           |||||||||||||| || ||||||| | |||| ||||||| |||  | |||||| || ||
Sbjct: 307 ttgtgtcagttgctgggtaatagtaacctgacagagtcttatggctttaagattgatgtt 366

                                   
Query: 364 aacagagctctgaagcttccttct 387
           || |||||||| || |||||||||
Sbjct: 367 aatagagctctcaaacttccttct 390