Jatropha Genome Database

JcCB0549911.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0549911.10 - phase: 0 
         (420 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

48762.m000011 conserved hypothetical protein                          226   8e-59
29822.m003482 Protein C10orf22, putative                               68   5e-11

>48762.m000011 conserved hypothetical protein
          Length = 162

 Score =  226 bits (114), Expect = 8e-59
 Identities = 141/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 265 atagggatcttctgtatgccaccatcctctattataccgcttcataatcatcctgggatg 324
           ||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1   atagggatcttctgtatgccaccttcttctatcataccgcttcataatcatcctgggatg 60

                                                                       
Query: 325 actgtattgagcaagcttctttatggttcattacttgtaaagtcatacgattggcttgat 384
           ||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 61  actgttttaagcaagcttctttatggttcattacttgtaaagtcttacgattggcttgac 120

                                         
Query: 385 ctccctgggtttgatgatccctctcaaggt 414
           || |||||||||||||||||||| ||||||
Sbjct: 121 ctacctgggtttgatgatccctcacaaggt 150


>29822.m003482 Protein C10orf22, putative
          Length = 867

 Score = 67.9 bits (34), Expect = 5e-11
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 304 cttcataatcatcctgggatgactgtattgagcaagct 341
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 412 cttcataatcatcctgggatgactgtatttagcaagct 449