Jatropha Genome Database

JcCB0546741.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0546741.10 + phase: 0 
         (1551 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29950.m001181 aromatic amino acid decarboxylase, putative              76   7e-13
27544.m000014 aromatic amino acid decarboxylase, putative              76   7e-13
29637.m000726 aromatic amino acid decarboxylase, putative              58   2e-07

>29950.m001181 aromatic amino acid decarboxylase, putative
          Length = 1338

 Score = 75.8 bits (38), Expect = 7e-13
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 1240 gacaagaggtttgagatagtggtgccaagaaattttgcaatggtttgctt 1289
            |||||||||||||||||||||||||||||||| |||||  ||||||||||
Sbjct: 1069 gacaagaggtttgagatagtggtgccaagaaagtttgctttggtttgctt 1118


>27544.m000014 aromatic amino acid decarboxylase, putative
          Length = 523

 Score = 75.8 bits (38), Expect = 7e-13
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 1240 gacaagaggtttgagatagtggtgccaagaaattttgcaatggtttgctt 1289
            |||||||||||||||||||||||||||||||| |||||  ||||||||||
Sbjct: 259  gacaagaggtttgagatagtggtgccaagaaaatttgctttggtttgctt 308


>29637.m000726 aromatic amino acid decarboxylase, putative
          Length = 1479

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 851 gcatatgggttcatgtggatgctgcttatgctggaaatgcttgtatatgcccagaat 907
           |||| ||| |||||||||||||||| |||||||||| ||||||| | || |||||||
Sbjct: 806 gcatgtggtttcatgtggatgctgcctatgctggaagtgcttgtgtttgtccagaat 862