Jatropha Genome Database
- JcCB0545911.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0545911.10 - phase: 0 /partial
(306 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30115.m001181 conserved hypothetical protein 133 7e-31
>30115.m001181 conserved hypothetical protein
Length = 660
Score = 133 bits (67), Expect = 7e-31
Identities = 242/300 (80%), Gaps = 9/300 (3%)
Strand = Plus / Plus
Query: 16 gaagtagaaacgtcagtttattatagctgtagagaaaggagagagaccacgccatcgagc 75
||||| |||||||| || || ||||||||||||||||| ||||| | ||||||||||||
Sbjct: 358 gaagttgaaacgtctgtgtactatagctgtagagaaagaagagaaagcacgccatcgagt 417
Query: 76 cagcttcgacctgaatcatcagacgaactggattccatagctagaccatcacc---ggag 132
|| || || |||| |||||||||||||||||| | || ||||||||| | ||||
Sbjct: 418 gaggttggagaagaattatcagacgaactggattctacggcaagaccatcagcaatggag 477
Query: 133 gcaaatactctccgcagatca------acggccgagaagatgccaacggagtctgagctt 186
|||||| | | ||| | | || |||| |||||||||||||||||| |||||||
Sbjct: 478 gcaaattcacgccgtaaaccatcattaacggtggagaagatgccaacggagactgagctc 537
Query: 187 gacgaattcttcacagaagccgagaaaagtatccaaaaacaatttgcagaaaagtataac 246
|| |||||||| ||||||| || | | ||| ||||||| ||||||||| |||||||||
Sbjct: 538 gatgaattctttgcagaagctgaaaggaatattcaaaaacgatttgcagacaagtataac 597
Query: 247 tacgatattgtcaaggacgagcccttggaaggacggtacgagtgggtgcgattaaagcca 306
|||||| | || ||||| || || ||| |||||||||||||||||||| |||||||||||
Sbjct: 598 tacgatgtcgtgaaggatgaaccattgaaaggacggtacgagtgggtgagattaaagcca 657