Jatropha Genome Database
- JcCB0542741.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0542741.10 + phase: 0 /partial
(291 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30146.m003502 Auxin-responsive protein IAA6, putative 272 1e-72
29794.m003410 conserved hypothetical protein 66 1e-10
30008.m000799 Auxin-responsive protein IAA13, putative 50 7e-06
29883.m001993 Auxin-induced protein AUX28, putative 50 7e-06
>30146.m003502 Auxin-responsive protein IAA6, putative
Length = 963
Score = 272 bits (137), Expect = 1e-72
Identities = 244/281 (86%), Gaps = 9/281 (3%)
Strand = Plus / Plus
Query: 10 tgcaagaaagggatgtttgtgaagatcaatatggatggtgttcctattggaaggaaagta 69
||||| ||||| ||||||| ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 619 tgcaaaaaaggtctgtttgttaagatcaatatggatggtgttcccattggaagaaaagta 678
Query: 70 gatcttaaagcctatgacagctatgagaagctttctactgctgttgatgaactattcaga 129
|||||| ||||||||||||| |||||||| | || | |||||| |||||||| ||||||
Sbjct: 679 gatcttcaagcctatgacagttatgagaaattatccattgctgtggatgaactcttcaga 738
Query: 130 ggcctacttgcagctcaaagagattcctctgctggtggaatcatgagcaagcaagaggaa 189
||||| |||||||||||||| ||||||||||||||| | ||||||||||||
Sbjct: 739 ggcctccttgcagctcaaagggattcctctgctggt---------accaagcaagaggag 789
Query: 190 gagaaagcaattacgggtgtattagatgggagtggggaatatacgcttgtttatgaggat 249
||||||||||||||||| ||||| || || || ||||||||||| ||||||||||| |||
Sbjct: 790 gagaaagcaattacgggcgtattggacggaagcggggaatatacccttgtttatgaagat 849
Query: 250 aatgaaggagacaggatgcttgttggggatgtcccatggca 290
|| |||||||||||||||||||||||||||||||| |||||
Sbjct: 850 aacgaaggagacaggatgcttgttggggatgtcccgtggca 890
>29794.m003410 conserved hypothetical protein
Length = 1104
Score = 65.9 bits (33), Expect = 1e-10
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 226 gaatatacgcttgtttatgaggataatgaaggagacaggatgcttgttggggatgtccca 285
||||||||||| || || ||||||| |||||| |||||||| |||||||| ||||||||
Sbjct: 880 gaatatacgctagtgtacgaggatagtgaaggcgacaggatacttgttggagatgtcccc 939
Query: 286 tggca 290
|||||
Sbjct: 940 tggca 944
Score = 58.0 bits (29), Expect = 3e-08
Identities = 101/125 (80%)
Strand = Plus / Plus
Query: 25 tttgtgaagatcaatatggatggtgttcctattggaaggaaagtagatcttaaagcctat 84
||||| ||||| |||||||| || | || |||||||| ||| || |||| || |||||
Sbjct: 673 tttgtaaagattaatatggaaggaatccccattggaagaaaaataaatctcaatgcctac 732
Query: 85 gacagctatgagaagctttctactgctgttgatgaactattcagaggcctacttgcagct 144
||||||||||| || || || | |||| ||||||| || ||||| || || |||||||||
Sbjct: 733 gacagctatgaaaaactatccattgctattgatgagctcttcagtggactgcttgcagct 792
Query: 145 caaag 149
|||||
Sbjct: 793 caaag 797
>30008.m000799 Auxin-responsive protein IAA13, putative
Length = 957
Score = 50.1 bits (25), Expect = 7e-06
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 240 ttatgaggataatgaaggagacaggatgcttgttggggatgtcccatgg 288
|||||| ||||| ||||| ||| ||||||||||||| ||||| ||||||
Sbjct: 795 ttatgaagataaagaaggggactggatgcttgttggagatgttccatgg 843
>29883.m001993 Auxin-induced protein AUX28, putative
Length = 735
Score = 50.1 bits (25), Expect = 7e-06
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 240 ttatgaggataatgaaggagacaggatgcttgttggggatgtccc 284
|||||| ||||| || || ||| ||||||||||||||||||||||
Sbjct: 585 ttatgaagataaggatggtgactggatgcttgttggggatgtccc 629