Jatropha Genome Database

JcCB0542741.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0542741.10 + phase: 0 /partial
         (291 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30146.m003502 Auxin-responsive protein IAA6, putative                 272   1e-72
29794.m003410 conserved hypothetical protein                           66   1e-10
30008.m000799 Auxin-responsive protein IAA13, putative                 50   7e-06
29883.m001993 Auxin-induced protein AUX28, putative                    50   7e-06

>30146.m003502 Auxin-responsive protein IAA6, putative
          Length = 963

 Score =  272 bits (137), Expect = 1e-72
 Identities = 244/281 (86%), Gaps = 9/281 (3%)
 Strand = Plus / Plus

                                                                       
Query: 10  tgcaagaaagggatgtttgtgaagatcaatatggatggtgttcctattggaaggaaagta 69
           ||||| |||||  ||||||| ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 619 tgcaaaaaaggtctgtttgttaagatcaatatggatggtgttcccattggaagaaaagta 678

                                                                       
Query: 70  gatcttaaagcctatgacagctatgagaagctttctactgctgttgatgaactattcaga 129
           |||||| ||||||||||||| ||||||||  | || | |||||| |||||||| ||||||
Sbjct: 679 gatcttcaagcctatgacagttatgagaaattatccattgctgtggatgaactcttcaga 738

                                                                       
Query: 130 ggcctacttgcagctcaaagagattcctctgctggtggaatcatgagcaagcaagaggaa 189
           ||||| |||||||||||||| |||||||||||||||         | |||||||||||| 
Sbjct: 739 ggcctccttgcagctcaaagggattcctctgctggt---------accaagcaagaggag 789

                                                                       
Query: 190 gagaaagcaattacgggtgtattagatgggagtggggaatatacgcttgtttatgaggat 249
           ||||||||||||||||| ||||| || || || ||||||||||| ||||||||||| |||
Sbjct: 790 gagaaagcaattacgggcgtattggacggaagcggggaatatacccttgtttatgaagat 849

                                                    
Query: 250 aatgaaggagacaggatgcttgttggggatgtcccatggca 290
           || |||||||||||||||||||||||||||||||| |||||
Sbjct: 850 aacgaaggagacaggatgcttgttggggatgtcccgtggca 890


>29794.m003410 conserved hypothetical protein
          Length = 1104

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 226 gaatatacgcttgtttatgaggataatgaaggagacaggatgcttgttggggatgtccca 285
           ||||||||||| || || ||||||| |||||| |||||||| |||||||| |||||||| 
Sbjct: 880 gaatatacgctagtgtacgaggatagtgaaggcgacaggatacttgttggagatgtcccc 939

                
Query: 286 tggca 290
           |||||
Sbjct: 940 tggca 944



 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                       
Query: 25  tttgtgaagatcaatatggatggtgttcctattggaaggaaagtagatcttaaagcctat 84
           ||||| ||||| |||||||| ||  | || |||||||| ||| || |||| || ||||| 
Sbjct: 673 tttgtaaagattaatatggaaggaatccccattggaagaaaaataaatctcaatgcctac 732

                                                                       
Query: 85  gacagctatgagaagctttctactgctgttgatgaactattcagaggcctacttgcagct 144
           ||||||||||| || || || | |||| ||||||| || ||||| || || |||||||||
Sbjct: 733 gacagctatgaaaaactatccattgctattgatgagctcttcagtggactgcttgcagct 792

                
Query: 145 caaag 149
           |||||
Sbjct: 793 caaag 797


>30008.m000799 Auxin-responsive protein IAA13, putative
          Length = 957

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 240 ttatgaggataatgaaggagacaggatgcttgttggggatgtcccatgg 288
           |||||| ||||| ||||| ||| ||||||||||||| ||||| ||||||
Sbjct: 795 ttatgaagataaagaaggggactggatgcttgttggagatgttccatgg 843


>29883.m001993 Auxin-induced protein AUX28, putative
          Length = 735

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 240 ttatgaggataatgaaggagacaggatgcttgttggggatgtccc 284
           |||||| ||||| || || ||| ||||||||||||||||||||||
Sbjct: 585 ttatgaagataaggatggtgactggatgcttgttggggatgtccc 629