Jatropha Genome Database

JcCB0539181.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0539181.10 - phase: 0 
         (324 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29646.m001115 rab11, putative                                         145   2e-34
29900.m001554 rab11, putative                                         137   4e-32
30209.m001527 rab11, putative                                         113   7e-25
29751.m001858 rab11, putative                                          76   1e-13
28134.m000170 rab11, putative                                          58   3e-08
30026.m001462 rab11, putative                                          56   1e-07
30152.m002403 rab11, putative                                          52   2e-06

>29646.m001115 rab11, putative
          Length = 651

 Score =  145 bits (73), Expect = 2e-34
 Identities = 184/221 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
           ||||||||||| || ||||| ||||||||||| ||||| || ||||| ||  | || |||
Sbjct: 1   atgggggcttatagagcagatgatgattatgattacttgtttaaggttgttttaataggt 60

                                                                       
Query: 61  gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
           ||||| || ||||| ||||||||||| || || ||||| || || ||||||||| |  | 
Sbjct: 61  gattctggtgttgggaaatcaaatctgttgtctagattcacaaggaatgaattcagcttg 120

                                                                       
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
           ||||| ||||| ||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 121 gaatccaaatccaccattggtgttgaatttgctactcgtagtatccatgttgatgacaag 180

                                                    
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaag 221
           || || |||||||||||||||||||| ||||||||||||||
Sbjct: 181 gttgttaaggcccagatttgggacactgctggtcaggaaag 221


>29900.m001554 rab11, putative
          Length = 654

 Score =  137 bits (69), Expect = 4e-32
 Identities = 186/225 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
           ||||| || ||||| || || |||||||||||||| || |||||||||||| | ||||| 
Sbjct: 1   atgggagcatacagagcggatgatgattatgactatttgttcaaggtggtattgattgga 60

                                                                       
Query: 61  gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
           ||||| || ||||| ||||| ||||| |||||  | ||||| |||||||||||| | |||
Sbjct: 61  gattcaggtgttggcaaatctaatctcttatctcgttttaccagaaatgaattcagcctt 120

                                                                       
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
           ||||| ||||| || || || ||||||||||| ||||| || || || || || || |||
Sbjct: 121 gaatccaaatccacaatcggagttgaattcgctacccgcagtatacacgttgatgataag 180

                                                        
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaaggtat 225
           || |||||||||||||||||||| || ||||| || |||||||||
Sbjct: 181 gttgtcaaggcccagatttgggatactgctggccaagaaaggtat 225


>30209.m001527 rab11, putative
          Length = 648

 Score =  113 bits (57), Expect = 7e-25
 Identities = 180/221 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
           |||| ||| ||||| ||||| || ||||| |||||  |||||||||||||  | || || 
Sbjct: 1   atggcggcgtacagagcagaggacgattacgactatctattcaaggtggtgttgatagga 60

                                                                       
Query: 61  gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
           ||||| || || || |||||||||||  | || ||||| || |||||||||||| | |||
Sbjct: 61  gattcaggtgtagggaaatcaaatctactctccagattcactagaaatgaattcagcctt 120

                                                                       
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
           ||||| ||||| || || |||||||||||||| ||||| || ||||  ||||| || |||
Sbjct: 121 gaatccaaatccactatcggtgttgaattcgctacccgtagtatccgcgtcgatgataag 180

                                                    
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaag 221
            ||||||| |||||||||||||| |||||||| || |||||
Sbjct: 181 atcgtcaaagcccagatttgggataccgctggccaagaaag 221


>29751.m001858 rab11, putative
          Length = 651

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 55  attggtgattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattc 114
           ||||| ||||| || ||||||||||| ||| || | || || ||||| |||||||| |||
Sbjct: 52  attggggattcaggtgttggaaaatctaatattctgtctaggtttactagaaatgagttc 111

                                                     
Query: 115 tgtcttgaatctaaatctaccataggtgttgaattcgccacc 156
           ||| | ||||||||||| || || ||||||||||||||||||
Sbjct: 112 tgtttggaatctaaatccactatcggtgttgaattcgccacc 153


>28134.m000170 rab11, putative
          Length = 669

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 70  gttggaaaatcaaatcttttatcaagatttacgagaaatgaattc 114
           ||||| |||||||||||||||||||||||| | ||| ||||||||
Sbjct: 67  gttgggaaatcaaatcttttatcaagattttctagagatgaattc 111


>30026.m001462 rab11, putative
          Length = 657

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 185 tcaaggcccagatttgggacaccgctggtcaggaaaggta 224
           ||||||||||||||||||| || |||||||| ||||||||
Sbjct: 185 tcaaggcccagatttgggatactgctggtcaagaaaggta 224


>30152.m002403 rab11, putative
          Length = 672

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 184 gtcaaggcccagatttgggacaccgctggtcaggaaaggtat 225
           |||||||| |||||||||||||| |||||||| ||| |||||
Sbjct: 190 gtcaaggctcagatttgggacactgctggtcaagaacggtat 231