Jatropha Genome Database
- JcCB0539181.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0539181.10 - phase: 0
(324 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29646.m001115 rab11, putative 145 2e-34
29900.m001554 rab11, putative 137 4e-32
30209.m001527 rab11, putative 113 7e-25
29751.m001858 rab11, putative 76 1e-13
28134.m000170 rab11, putative 58 3e-08
30026.m001462 rab11, putative 56 1e-07
30152.m002403 rab11, putative 52 2e-06
>29646.m001115 rab11, putative
Length = 651
Score = 145 bits (73), Expect = 2e-34
Identities = 184/221 (83%)
Strand = Plus / Plus
Query: 1 atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
||||||||||| || ||||| ||||||||||| ||||| || ||||| || | || |||
Sbjct: 1 atgggggcttatagagcagatgatgattatgattacttgtttaaggttgttttaataggt 60
Query: 61 gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
||||| || ||||| ||||||||||| || || ||||| || || ||||||||| | |
Sbjct: 61 gattctggtgttgggaaatcaaatctgttgtctagattcacaaggaatgaattcagcttg 120
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
||||| ||||| ||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 121 gaatccaaatccaccattggtgttgaatttgctactcgtagtatccatgttgatgacaag 180
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaag 221
|| || |||||||||||||||||||| ||||||||||||||
Sbjct: 181 gttgttaaggcccagatttgggacactgctggtcaggaaag 221
>29900.m001554 rab11, putative
Length = 654
Score = 137 bits (69), Expect = 4e-32
Identities = 186/225 (82%)
Strand = Plus / Plus
Query: 1 atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
||||| || ||||| || || |||||||||||||| || |||||||||||| | |||||
Sbjct: 1 atgggagcatacagagcggatgatgattatgactatttgttcaaggtggtattgattgga 60
Query: 61 gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
||||| || ||||| ||||| ||||| ||||| | ||||| |||||||||||| | |||
Sbjct: 61 gattcaggtgttggcaaatctaatctcttatctcgttttaccagaaatgaattcagcctt 120
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
||||| ||||| || || || ||||||||||| ||||| || || || || || || |||
Sbjct: 121 gaatccaaatccacaatcggagttgaattcgctacccgcagtatacacgttgatgataag 180
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaaggtat 225
|| |||||||||||||||||||| || ||||| || |||||||||
Sbjct: 181 gttgtcaaggcccagatttgggatactgctggccaagaaaggtat 225
>30209.m001527 rab11, putative
Length = 648
Score = 113 bits (57), Expect = 7e-25
Identities = 180/221 (81%)
Strand = Plus / Plus
Query: 1 atgggggcttacagggcagacgatgattatgactacttattcaaggtggtacttattggt 60
|||| ||| ||||| ||||| || ||||| ||||| ||||||||||||| | || ||
Sbjct: 1 atggcggcgtacagagcagaggacgattacgactatctattcaaggtggtgttgatagga 60
Query: 61 gattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattctgtctt 120
||||| || || || ||||||||||| | || ||||| || |||||||||||| | |||
Sbjct: 61 gattcaggtgtagggaaatcaaatctactctccagattcactagaaatgaattcagcctt 120
Query: 121 gaatctaaatctaccataggtgttgaattcgccacccgaagcatccatgtcgacgacaag 180
||||| ||||| || || |||||||||||||| ||||| || |||| ||||| || |||
Sbjct: 121 gaatccaaatccactatcggtgttgaattcgctacccgtagtatccgcgtcgatgataag 180
Query: 181 gtcgtcaaggcccagatttgggacaccgctggtcaggaaag 221
||||||| |||||||||||||| |||||||| || |||||
Sbjct: 181 atcgtcaaagcccagatttgggataccgctggccaagaaag 221
>29751.m001858 rab11, putative
Length = 651
Score = 75.8 bits (38), Expect = 1e-13
Identities = 86/102 (84%)
Strand = Plus / Plus
Query: 55 attggtgattccggcgttggaaaatcaaatcttttatcaagatttacgagaaatgaattc 114
||||| ||||| || ||||||||||| ||| || | || || ||||| |||||||| |||
Sbjct: 52 attggggattcaggtgttggaaaatctaatattctgtctaggtttactagaaatgagttc 111
Query: 115 tgtcttgaatctaaatctaccataggtgttgaattcgccacc 156
||| | ||||||||||| || || ||||||||||||||||||
Sbjct: 112 tgtttggaatctaaatccactatcggtgttgaattcgccacc 153
>28134.m000170 rab11, putative
Length = 669
Score = 58.0 bits (29), Expect = 3e-08
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 70 gttggaaaatcaaatcttttatcaagatttacgagaaatgaattc 114
||||| |||||||||||||||||||||||| | ||| ||||||||
Sbjct: 67 gttgggaaatcaaatcttttatcaagattttctagagatgaattc 111
>30026.m001462 rab11, putative
Length = 657
Score = 56.0 bits (28), Expect = 1e-07
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 185 tcaaggcccagatttgggacaccgctggtcaggaaaggta 224
||||||||||||||||||| || |||||||| ||||||||
Sbjct: 185 tcaaggcccagatttgggatactgctggtcaagaaaggta 224
>30152.m002403 rab11, putative
Length = 672
Score = 52.0 bits (26), Expect = 2e-06
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 184 gtcaaggcccagatttgggacaccgctggtcaggaaaggtat 225
|||||||| |||||||||||||| |||||||| ||| |||||
Sbjct: 190 gtcaaggctcagatttgggacactgctggtcaagaacggtat 231