Jatropha Genome Database

JcCB0534431.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0534431.10 + phase: 0 /partial
         (312 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29804.m001508 Glutathione-regulated potassium-efflux system prot...    70   8e-12

>29804.m001508 Glutathione-regulated potassium-efflux system protein
            kefB, putative
          Length = 2283

 Score = 69.9 bits (35), Expect = 8e-12
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                        
Query: 20   ttatgaaaccattgcaggtgagagttgatgactcacttgtggcccaagaacccattctac 79
            ||||||||||||||||||| ||||||| ||||||  ||| | |||||| |||    | ||
Sbjct: 2009 ttatgaaaccattgcaggtaagagttgttgactcggttgcgacccaagtacctccgccac 2068

                                                       
Query: 80   caacatcatctgaagacaaattatcaagaagaaagcagatgga 122
            || ||||| || |||||||||||||||||||| | ||||||||
Sbjct: 2069 catcatcacctcaagacaaattatcaagaagagaacagatgga 2111