Jatropha Genome Database
- JcCB0533111.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0533111.10 + phase: 0 /partial
(318 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27810.m000636 conserved hypothetical protein 90 9e-18
>27810.m000636 conserved hypothetical protein
Length = 3165
Score = 89.7 bits (45), Expect = 9e-18
Identities = 66/73 (90%)
Strand = Plus / Plus
Query: 38 aggatggatttgagttgccttcacgcctctcagtatctgctgctgattgtattttagcta 97
||||||| ||||||||||| || |||||||||||||||||||||||||| || |||||||
Sbjct: 575 aggatggctttgagttgccctctcgcctctcagtatctgctgctgattgcatattagcta 634
Query: 98 tcactgaagcatt 110
||| ||| |||||
Sbjct: 635 tcagtgaggcatt 647
Score = 77.8 bits (39), Expect = 4e-14
Identities = 78/91 (85%)
Strand = Plus / Plus
Query: 228 taaatcatcagaagagtcaacctttgacatggcatacttgctttgggacttgatagggga 287
|||||||| ||| || |||| ||||||||||||| ||||||||||||||||||| |||
Sbjct: 744 taaatcattagatgactcaaattttgacatggcattcttgctttgggacttgataaagga 803
Query: 288 acttattactctaacacagagactgcttgct 318
|||||||||||| |||||||| ||||||
Sbjct: 804 gcttattactctagtgcagagactccttgct 834