Jatropha Genome Database

JcCB0523501.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0523501.10 - phase: 0 /partial
         (747 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30055.m001531 Male sterility protein, putative                         64   1e-09
30055.m001532 oxidoreductase, acting on the CH-CH group of donor...    62   5e-09

>30055.m001531 Male sterility protein, putative
          Length = 1482

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 53  tacgtccaaccatggttactagtacttggagagaaccttttcctggttggattgaaggtg 112
           |||| ||||||||| | || |||||||  |||||||| ||||||||||||||||||||||
Sbjct: 779 tacggccaaccatgataacaagtacttatagagaaccatttcctggttggattgaaggtg 838


>30055.m001532 oxidoreductase, acting on the CH-CH group of donors,
           putative
          Length = 1245

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggagaaatgattgtaggacatttgaaggaaaatctgccaatggtgatcgtacgtcca 60
           |||||||| ||||||||||||||||||||||| ||| || |  | || ||  |||| || 
Sbjct: 496 atgggagagatgattgtaggacatttgaaggagaatttgtccgtagtcattttacgaccc 555

                                                                      
Query: 61  accatggttactagtacttggagagaaccttttcctggttggattgaaggtgtaagaac 119
           |||||  | || |||||||  | ||||||||||||||||||| ||||||| || |||||
Sbjct: 556 accattataacaagtacttacaaagaaccttttcctggttgggttgaaggggtcagaac 614