Jatropha Genome Database
- JcCB0498421.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0498421.10 - phase: 0 /partial
(288 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29869.m001194 Aquaporin PIP2.7, putative 333 3e-91
28076.m000411 Aquaporin PIP2.1, putative 92 2e-18
30174.m008614 Aquaporin PIP1.3, putative 80 8e-15
30078.m002337 Aquaporin PIP2.2, putative 80 8e-15
27516.m000174 Aquaporin PIP2.1, putative 76 1e-13
29669.m000809 Aquaporin PIP1.3, putative 60 7e-09
29669.m000808 Aquaporin PIP1.3, putative 60 7e-09
28962.m000436 conserved hypothetical protein 52 2e-06
>29869.m001194 Aquaporin PIP2.7, putative
Length = 843
Score = 333 bits (168), Expect = 3e-91
Identities = 246/272 (90%)
Strand = Plus / Plus
Query: 17 gtgaagaaacgcaaactacccatgcaaaggattatgttgatccaccacctgcgccactga 76
|||||||||| ||||||| ||||| |||||||||||| ||||||||||| || |||||
Sbjct: 17 gtgaagaaacacaaactagccatggaaaggattatgtggatccaccaccagcaccacttg 76
Query: 77 tcgacatggctgaaatcaagctctggtctttctacagagctttaatagctgagttcatag 136
| |||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 77 ttgacatggctgaactcaagctctggtctttctacagagctcttatagctgagttcatag 136
Query: 137 ccactctccttttcctttacataactgtagccactgtaattggctacaagaaacaaactg 196
| |||||||| ||||| ||||| || ||||| |||||||||||||| |||||||||||||
Sbjct: 137 ctactctcctcttcctctacatcaccgtagctactgtaattggctataagaaacaaactg 196
Query: 197 atccatgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatcttta 256
| |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||
Sbjct: 197 acccatgtggtggagttggtatcttgggtattgcatgggcctttggtggcatgatcttta 256
Query: 257 tccttgtttactgcactgccggtatatctggt 288
||||||| ||||||||||| ||||| ||||||
Sbjct: 257 tccttgtctactgcactgctggtatctctggt 288
>28076.m000411 Aquaporin PIP2.1, putative
Length = 864
Score = 91.7 bits (46), Expect = 2e-18
Identities = 76/86 (88%)
Strand = Plus / Plus
Query: 202 tgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatctttatcctt 261
|||||||| |||||| || | || ||||| ||||| |||||||||||||||||||| |||
Sbjct: 229 tgtggtggtgttggtattcttggtattgcttgggcttttggtggcatgatctttattctt 288
Query: 262 gtttactgcactgccggtatatctgg 287
|||||||||||||| ||||| |||||
Sbjct: 289 gtttactgcactgctggtatttctgg 314
>30174.m008614 Aquaporin PIP1.3, putative
Length = 861
Score = 79.8 bits (40), Expect = 8e-15
Identities = 55/60 (91%)
Strand = Plus / Plus
Query: 222 gggcattgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtat 281
||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |||||
Sbjct: 264 gggcattgcttgggcttttggtggcatgatctttgcccttgtttactgcactgctggtat 323
>30078.m002337 Aquaporin PIP2.2, putative
Length = 867
Score = 79.8 bits (40), Expect = 8e-15
Identities = 70/80 (87%)
Strand = Plus / Plus
Query: 202 tgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatctttatcctt 261
||||||||||||||| || | ||||| || |||||||| ||||||||||| || || ||
Sbjct: 226 tgtggtggagttggtattcttggcatcgcttgggccttcggtggcatgattttcattctc 285
Query: 262 gtttactgcactgccggtat 281
||||||||||||||||||||
Sbjct: 286 gtttactgcactgccggtat 305
>27516.m000174 Aquaporin PIP2.1, putative
Length = 852
Score = 75.8 bits (38), Expect = 1e-13
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtatatct 285
||||| ||||| ||||||||||||||||| || ||||||||||||||||| ||||| |||
Sbjct: 235 attgcttgggcttttggtggcatgatcttcattcttgtttactgcactgctggtatttct 294
Query: 286 gg 287
||
Sbjct: 295 gg 296
>29669.m000809 Aquaporin PIP1.3, putative
Length = 867
Score = 60.0 bits (30), Expect = 7e-09
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgc 275
||||| |||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 274 attgcttgggcctttggtggcatgatctttgctcttgtttactgtactgc 323
>29669.m000808 Aquaporin PIP1.3, putative
Length = 864
Score = 60.0 bits (30), Expect = 7e-09
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgc 275
||||| |||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 274 attgcttgggcctttggtggcatgatctttgctcttgtttactgtactgc 323
>28962.m000436 conserved hypothetical protein
Length = 162
Score = 52.0 bits (26), Expect = 2e-06
Identities = 56/66 (84%)
Strand = Plus / Plus
Query: 223 ggcattgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtata 282
|||||||| ||||| ||||||||||||||||| || |||| || |||||||| || ||
Sbjct: 91 ggcattgcttgggcttttggtggcatgatcttcattcttgactattgcactgctgggatt 150
Query: 283 tctggt 288
||||||
Sbjct: 151 tctggt 156