Jatropha Genome Database

JcCB0498421.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0498421.10 - phase: 0 /partial
         (288 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29869.m001194 Aquaporin PIP2.7, putative                              333   3e-91
28076.m000411 Aquaporin PIP2.1, putative                               92   2e-18
30174.m008614 Aquaporin PIP1.3, putative                               80   8e-15
30078.m002337 Aquaporin PIP2.2, putative                               80   8e-15
27516.m000174 Aquaporin PIP2.1, putative                               76   1e-13
29669.m000809 Aquaporin PIP1.3, putative                               60   7e-09
29669.m000808 Aquaporin PIP1.3, putative                               60   7e-09
28962.m000436 conserved hypothetical protein                           52   2e-06

>29869.m001194 Aquaporin PIP2.7, putative
          Length = 843

 Score =  333 bits (168), Expect = 3e-91
 Identities = 246/272 (90%)
 Strand = Plus / Plus

                                                                       
Query: 17  gtgaagaaacgcaaactacccatgcaaaggattatgttgatccaccacctgcgccactga 76
           |||||||||| ||||||| ||||| |||||||||||| ||||||||||| || |||||  
Sbjct: 17  gtgaagaaacacaaactagccatggaaaggattatgtggatccaccaccagcaccacttg 76

                                                                       
Query: 77  tcgacatggctgaaatcaagctctggtctttctacagagctttaatagctgagttcatag 136
           | |||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 77  ttgacatggctgaactcaagctctggtctttctacagagctcttatagctgagttcatag 136

                                                                       
Query: 137 ccactctccttttcctttacataactgtagccactgtaattggctacaagaaacaaactg 196
           | |||||||| ||||| ||||| || ||||| |||||||||||||| |||||||||||||
Sbjct: 137 ctactctcctcttcctctacatcaccgtagctactgtaattggctataagaaacaaactg 196

                                                                       
Query: 197 atccatgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatcttta 256
           | |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||
Sbjct: 197 acccatgtggtggagttggtatcttgggtattgcatgggcctttggtggcatgatcttta 256

                                           
Query: 257 tccttgtttactgcactgccggtatatctggt 288
           ||||||| ||||||||||| ||||| ||||||
Sbjct: 257 tccttgtctactgcactgctggtatctctggt 288


>28076.m000411 Aquaporin PIP2.1, putative
          Length = 864

 Score = 91.7 bits (46), Expect = 2e-18
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 202 tgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatctttatcctt 261
           |||||||| |||||| || | || ||||| ||||| |||||||||||||||||||| |||
Sbjct: 229 tgtggtggtgttggtattcttggtattgcttgggcttttggtggcatgatctttattctt 288

                                     
Query: 262 gtttactgcactgccggtatatctgg 287
           |||||||||||||| ||||| |||||
Sbjct: 289 gtttactgcactgctggtatttctgg 314


>30174.m008614 Aquaporin PIP1.3, putative
          Length = 861

 Score = 79.8 bits (40), Expect = 8e-15
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                       
Query: 222 gggcattgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtat 281
           ||||||||| ||||| ||||||||||||||||||  |||||||||||||||||| |||||
Sbjct: 264 gggcattgcttgggcttttggtggcatgatctttgcccttgtttactgcactgctggtat 323


>30078.m002337 Aquaporin PIP2.2, putative
          Length = 867

 Score = 79.8 bits (40), Expect = 8e-15
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                       
Query: 202 tgtggtggagttggtcttttgggcattgcatgggcctttggtggcatgatctttatcctt 261
           ||||||||||||||| || | ||||| || |||||||| ||||||||||| || || || 
Sbjct: 226 tgtggtggagttggtattcttggcatcgcttgggccttcggtggcatgattttcattctc 285

                               
Query: 262 gtttactgcactgccggtat 281
           ||||||||||||||||||||
Sbjct: 286 gtttactgcactgccggtat 305


>27516.m000174 Aquaporin PIP2.1, putative
          Length = 852

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtatatct 285
           ||||| ||||| ||||||||||||||||| || ||||||||||||||||| ||||| |||
Sbjct: 235 attgcttgggcttttggtggcatgatcttcattcttgtttactgcactgctggtatttct 294

             
Query: 286 gg 287
           ||
Sbjct: 295 gg 296


>29669.m000809 Aquaporin PIP1.3, putative
          Length = 867

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgc 275
           ||||| ||||||||||||||||||||||||   ||||||||||| |||||
Sbjct: 274 attgcttgggcctttggtggcatgatctttgctcttgtttactgtactgc 323


>29669.m000808 Aquaporin PIP1.3, putative
          Length = 864

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 226 attgcatgggcctttggtggcatgatctttatccttgtttactgcactgc 275
           ||||| ||||||||||||||||||||||||   ||||||||||| |||||
Sbjct: 274 attgcttgggcctttggtggcatgatctttgctcttgtttactgtactgc 323


>28962.m000436 conserved hypothetical protein
          Length = 162

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 223 ggcattgcatgggcctttggtggcatgatctttatccttgtttactgcactgccggtata 282
           |||||||| ||||| ||||||||||||||||| || ||||  || |||||||| || || 
Sbjct: 91  ggcattgcttgggcttttggtggcatgatcttcattcttgactattgcactgctgggatt 150

                 
Query: 283 tctggt 288
           ||||||
Sbjct: 151 tctggt 156