Jatropha Genome Database

JcCB0480341.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0480341.10 - phase: 0 /partial
         (290 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007139 arginine decarboxylase, putative                        100   9e-21

>30131.m007139 arginine decarboxylase, putative
          Length = 2175

 Score = 99.6 bits (50), Expect = 9e-21
 Identities = 74/82 (90%)
 Strand = Plus / Plus

                                                                       
Query: 161 attggtcaccttccctctctgccgctctctataagatcgacggatggggtgctccttact 220
           ||||||||||||||||||| ||||| || || ||| | ||||||||||||||||| || |
Sbjct: 146 attggtcaccttccctctccgccgcgctttacaagcttgacggatggggtgctccatatt 205

                                 
Query: 221 tttctgtcaactcctccggcaa 242
           ||||||||||||||||||||||
Sbjct: 206 tttctgtcaactcctccggcaa 227



 Score = 77.8 bits (39), Expect = 3e-14
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                         
Query: 8  ccctggcttgttgcgtagatgctgcccttgcgcctcccggctacgct 54
          |||||||||||||||||||| |||||||||||||||| |||||||||
Sbjct: 8  ccctggcttgttgcgtagattctgcccttgcgcctcctggctacgct 54