Jatropha Genome Database

JcCB0471851.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0471851.10 + phase: 0 /partial
         (469 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29780.m001378 hypothetical protein                                     60   1e-08

>29780.m001378 hypothetical protein
          Length = 441

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 49  actgggtatttagaagatgctttgctcgaatttagtgaacgt 90
           |||||||||||||| |||||||| |||||||||| |||||||
Sbjct: 124 actgggtatttagaggatgctttactcgaatttactgaacgt 165