Jatropha Genome Database

JcCB0471061.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0471061.10 - phase: 0 /pseudo
         (410 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30142.m000643 cytochrome P450, putative                                74   7e-13

>30142.m000643 cytochrome P450, putative
          Length = 1089

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 34  gtaatatcctctgcagaagcagcaaaagaggtcttgaaaacttatgatcttgactgttgc 93
           ||||| |||||||| ||||||||| |||||||| |||| | | ||||||||   ||||||
Sbjct: 229 gtaatttcctctgctgaagcagcagaagaggtcctgaagaatcatgatctttcttgttgc 288

                                    
Query: 94  agtagacctcgcttagttggtgcta 118
           |||||||||  ||||||||||||||
Sbjct: 289 agtagaccttccttagttggtgcta 313