Jatropha Genome Database

JcCB0463411.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0463411.10 - phase: 2 /pseudo/partial
         (259 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29848.m004648 conserved hypothetical protein                          178   1e-44
28320.m001111 conserved hypothetical protein                          107   3e-23
29680.m001658 conserved hypothetical protein                           68   3e-11

>29848.m004648 conserved hypothetical protein
          Length = 387

 Score =  178 bits (90), Expect = 1e-44
 Identities = 130/142 (91%), Gaps = 1/142 (0%)
 Strand = Plus / Plus

                                                                       
Query: 98  cccctcttcttctatgtcaatctcgccaagagatacatgcagcaacacaatgaagttgag 157
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 91  cccctctttttctacgtcaatctcgccaagagatacatgcagcaacacaatgaagttgaa 150

                                                                       
Query: 158 ctgtctgctcttggaatggctatagcaacagttgttacaattgctgagatcttgaag-at 216
           |||||||| |||||||||||||||||||||||||| || ||||| ||||| |||||| ||
Sbjct: 151 ctgtctgcacttggaatggctatagcaacagttgtgaccattgccgagatattgaagaat 210

                                 
Query: 217 aatgggctggctgttgagaaga 238
           |||||| ||||| |||| ||||
Sbjct: 211 aatgggttggctattgaaaaga 232


>28320.m001111 conserved hypothetical protein
          Length = 393

 Score =  107 bits (54), Expect = 3e-23
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 107 ttctatgtcaatctcgccaagagatacatgcagcaacacaatgaagttgagctgtctgct 166
           ||||||||||||||||||||||| || |||||||| |||||||| || ||||||||||||
Sbjct: 100 ttctatgtcaatctcgccaagaggtatatgcagcagcacaatgaggtggagctgtctgct 159

                         
Query: 167 cttggaatggctat 180
           ||||||||||||||
Sbjct: 160 cttggaatggctat 173


>29680.m001658 conserved hypothetical protein
          Length = 462

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                       
Query: 98  cccctcttcttctatgtcaatctcgccaagagatacatgcagcaacacaatgaagttgag 157
           ||||||||||| ||||||||||| || ||||| || || || || || || || || |||
Sbjct: 163 cccctcttcttttatgtcaatcttgctaagaggtatatacaacagcataacgaggtggag 222

                                                                     
Query: 158 ctgtctgctcttggaatggctatagcaacagttgttacaattgctgagatcttgaaga 215
           || |||||| | |||||||| ||  | |||||||| |||||||||||||| |||||||
Sbjct: 223 ctttctgctttgggaatggcaatcaccacagttgtcacaattgctgagattttgaaga 280