Jatropha Genome Database

JcCB0460891.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0460891.10 - phase: 0 
         (366 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30055.m001532 oxidoreductase, acting on the CH-CH group of donor...    56   1e-07

>30055.m001532 oxidoreductase, acting on the CH-CH group of donors,
           putative
          Length = 1245

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 88/108 (81%)
 Strand = Plus / Plus

                                                                       
Query: 139 ccatggattggtaaagatgaaaaacctgtcaaagttggtaaggttaaagtcttagacaac 198
           |||||||||||||| ||||  || |||||||| ||||| ||||| || ||  | |||| |
Sbjct: 853 ccatggattggtaaggatgggaagcctgtcaaggttggcaaggtgaaggttctcgacagc 912

                                                           
Query: 199 atgaatagctttcccagatatatggccctccgttacttgctattgcta 246
           |||  |||||| |  |||||||||||  | ||||||||||||||||||
Sbjct: 913 atggctagcttccgtagatatatggcagttcgttacttgctattgcta 960