Jatropha Genome Database

JcCB0459841.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0459841.20 + phase: 0 /partial
         (318 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m006985 hypothetical protein                                     86   1e-16

>30131.m006985 hypothetical protein
          Length = 912

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 151/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 119 cctttgacaacatctctggtatgatcactgtttgtgatatcttaaactcagctggctaca 178
           |||||||| ||||  |||| |||||| |||| |||||||||||| |||| || |||||  
Sbjct: 50  cctttgacgacattgctgggatgatcgctgtctgtgatatcttacactcggcgggctatg 109

                                                                       
Query: 179 gattcttaggctctaacactaactactattgggttcttgaagtttgtccagatgcaactg 238
           ||||||| |||| | ||||| ||||||| ||| ||||||| ||||  ||    || ||||
Sbjct: 110 gattcttgggctgtgacactgactactactggattcttgaggtttcaccgtcggccactg 169

                                                                       
Query: 239 agtttgctatgaaaacccaatataacaagttccttacacttctggagcccattaagaata 298
           |||||||||| |||| |||| ||||||||||  | |||||||| || || |||||| | |
Sbjct: 170 agtttgctatcaaaatccaaaataacaagttggtcacacttctagacccaattaaggaca 229

                  
Query: 299 acttccc 305
           |||||||
Sbjct: 230 acttccc 236