Jatropha Genome Database
- JcCB0456251.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0456251.10 - phase: 2 /pseudo/partial
(558 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30076.m004551 conserved hypothetical protein 78 6e-14
>30076.m004551 conserved hypothetical protein
Length = 2943
Score = 77.8 bits (39), Expect = 6e-14
Identities = 72/83 (86%)
Strand = Plus / Plus
Query: 269 gcttcattaggaggtcttcttggtggaatatttaaggggacggatacaggggagtccact 328
|||||| |||| ||||| | ||||||||||||||||| |||||||||||||| ||||
Sbjct: 193 gcttcactaggtggtctgttgggtggaatatttaagggaacggatacaggggaagccacg 252
Query: 329 aggcagcagtatgctccaactgt 351
||||| |||||||||| ||||||
Sbjct: 253 aggcaacagtatgctcaaactgt 275