Jatropha Genome Database

JcCB0456251.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0456251.10 - phase: 2 /pseudo/partial
         (558 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30076.m004551 conserved hypothetical protein                           78   6e-14

>30076.m004551 conserved hypothetical protein
          Length = 2943

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 269 gcttcattaggaggtcttcttggtggaatatttaaggggacggatacaggggagtccact 328
           |||||| |||| |||||  | ||||||||||||||||| ||||||||||||||  |||| 
Sbjct: 193 gcttcactaggtggtctgttgggtggaatatttaagggaacggatacaggggaagccacg 252

                                  
Query: 329 aggcagcagtatgctccaactgt 351
           ||||| |||||||||| ||||||
Sbjct: 253 aggcaacagtatgctcaaactgt 275