Jatropha Genome Database

JcCB0432051.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0432051.10 - phase: 0 /partial
         (512 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30009.m000840 U3 small nucleolar RNA-interacting protein, putative    135   3e-31

>30009.m000840 U3 small nucleolar RNA-interacting protein, putative
          Length = 1719

 Score =  135 bits (68), Expect = 3e-31
 Identities = 92/100 (92%)
 Strand = Plus / Plus

                                                                       
Query: 413 gattgagaagagctattgcttctagggttgaaaagccagaaactgttggtggattcgagg 472
           |||| |||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 404 gattaagaagagctattgcttctagggttgagaagcctgaaactgttggtggatttgagg 463

                                                   
Query: 473 tcctagtgaaacatcggcattctgttactgctgtatgtct 512
           | |||||||| ||| |||||||||| ||||||||||||||
Sbjct: 464 tactagtgaagcataggcattctgtaactgctgtatgtct 503