Jatropha Genome Database
- JcCB0427111.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0427111.10 + phase: 0
(426 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30147.m013971 conserved hypothetical protein 167 7e-41
>30147.m013971 conserved hypothetical protein
Length = 570
Score = 167 bits (84), Expect = 7e-41
Identities = 180/212 (84%)
Strand = Plus / Plus
Query: 146 atggaagcaaaaagatttcaaaggaagacttgaagaatcttccatgttttgattacaagg 205
|||||| ||||||||| ||||| || || ||||||||||| || || |||||||||||||
Sbjct: 152 atggaatcaaaaagatctcaaacgaggaattgaagaatctcccttgctttgattacaagg 211
Query: 206 ttgcagagaaaggagaaagtagccctgtggaatgtgttatttgcttagggaatttcaatg 265
|||||||||| || |||||| || ||| || || ||||||||| ||| |||||||
Sbjct: 212 cagcagagaaagaagggagtagctcttcggattgcgtagtttgcttagagaacttcaatg 271
Query: 266 taggtgataaatgcagattattgccaaattgcaatcacagctttcatagtcaatgcatag 325
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 272 taggtgataaatgcaagttattgccaaattgcaagcacagctttcactctcaatgcatag 331
Query: 326 attcgtggttagtgatggctcctatttgtcca 357
|||| ||||| |||| | ||||||||||||||
Sbjct: 332 attcttggttggtgaagactcctatttgtcca 363