Jatropha Genome Database

JcCB0424591.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0424591.10 - phase: 0 /partial
         (335 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29939.m000540 conserved hypothetical protein                           96   2e-19

>29939.m000540 conserved hypothetical protein
          Length = 462

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 143/172 (83%), Gaps = 2/172 (1%)
 Strand = Plus / Plus

                                                                       
Query: 155 ttgaacttcaattaggtcgtgctgaagaagaaacaagacgattgactcaaatttgggaag 214
           ||||||||||||| ||| | || ||||||||||| | ||| |||||||| ||||||||||
Sbjct: 146 ttgaacttcaattgggtagagcagaagaagaaactaaacgcttgactcagatttgggaag 205

                                                                       
Query: 215 agcttgaagtgatgtgc-gatccaatgagaaaagaagttgcaatggtacgaaaaaagatt 273
           |||||||| | ||  || ||||| |  |||||||||||||||||||| || || ||||||
Sbjct: 206 agcttgaa-tcattggctgatcctacaagaaaagaagttgcaatggtgcgcaagaagatt 264

                                                               
Query: 274 gatttggctaatcgagagttgaaaccattaggacagagctgccagaaaaagg 325
           ||  | || ||||||||| |||| ||| | ||||| ||||||||||| ||||
Sbjct: 265 gacgtagccaatcgagagctgaagccacttggacaaagctgccagaagaagg 316



 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                         
Query: 1  atgagaaacatgggaagtatgggaagtagtggaaggctatcaatgga 47
          |||||||||||||| || ||||| ||| |||||| ||||||||||||
Sbjct: 1  atgagaaacatgggcagcatgggcagtggtggaaagctatcaatgga 47