Jatropha Genome Database

JcCB0421541.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0421541.10 + phase: 0 
         (588 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29933.m001381 r2r3-myb transcription factor, putative                 135   3e-31
29631.m001031 r2r3-myb transcription factor, putative                  54   1e-06
28226.m000839 r2r3-myb transcription factor, putative                  54   1e-06
30147.m013953 conserved hypothetical protein                           52   4e-06
28154.m000040 r2r3-myb transcription factor, putative                  52   4e-06

>29933.m001381 r2r3-myb transcription factor, putative
          Length = 543

 Score =  135 bits (68), Expect = 3e-31
 Identities = 92/100 (92%)
 Strand = Plus / Plus

                                                                       
Query: 17  aatacaagaaaggcttatggacagaggaagaagacaagatcctgatggactatgtaaacc 76
           ||||||||||||| |||||||||||||||||||||||||| || ||||||||| ||||| 
Sbjct: 20  aatacaagaaaggattatggacagaggaagaagacaagattctcatggactatataaacg 79

                                                   
Query: 77  ttcatgggaaaggaaaatggaatcacatttcaaagaagac 116
           ||||||||||||||| ||||||||||||| | ||||||||
Sbjct: 80  ttcatgggaaaggaagatggaatcacattgcgaagaagac 119



 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 249 gtggtcactgattgcaaaacgagtgcctggaagaactgacaatcaagtgaagaactactg 308
           ||||||||||||||| || || ||||||||  |||||||||||||||| ||||| |||||
Sbjct: 150 gtggtcactgattgccaagcgggtgcctgggcgaactgacaatcaagtaaagaattactg 209

                 
Query: 309 gaatac 314
           ||||||
Sbjct: 210 gaatac 215


>29631.m001031 r2r3-myb transcription factor, putative
          Length = 267

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 115 acagggttgaaaagatgtggaaagagctgtaggctaaggtggttgaa 161
           ||||||||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 115 acagggttgaagaggtgtggaaagagctgcagactaagatggttgaa 161


>28226.m000839 r2r3-myb transcription factor, putative
          Length = 843

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 109 aagaagacagggttgaaaagatgtggaaagagctgtaggctaaggtggttgaattactt 167
           ||||| ||||| || || ||||||||||||||||| |||||  | ||||||||||||||
Sbjct: 124 aagaaaacaggtttaaagagatgtggaaagagctgcaggcttcgctggttgaattactt 182


>30147.m013953 conserved hypothetical protein
          Length = 258

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 203 aagaagaagaccttatcattagacttcataatct 236
           |||||||||||||||||||| | |||||||||||
Sbjct: 134 aagaagaagaccttatcattcgtcttcataatct 167


>28154.m000040 r2r3-myb transcription factor, putative
          Length = 906

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 127 agatgtggaaagagctgtaggctaaggtggttgaattacttaagccctaatgtgaaaaga 186
           |||||||| ||||| || || || || ||| | |||||||| || ||| || | ||||||
Sbjct: 142 agatgtggcaagagttgcagactcagatggataaattacttgaggcctgatcttaaaaga 201

                                                         
Query: 187 gggaattttactgaagaagaagaagaccttatcattagacttcata 232
           || || ||||||||||||||||| || ||||| ||||  |||||||
Sbjct: 202 ggcaactttactgaagaagaagatgagcttattattaagcttcata 247