Jatropha Genome Database

JcCB0420431.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0420431.10 + phase: 2 /partial
         (337 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30093.m000358 ATP phosphoribosyltransferase, putative                 167   5e-41

>30093.m000358 ATP phosphoribosyltransferase, putative
          Length = 480

 Score =  167 bits (84), Expect = 5e-41
 Identities = 120/132 (90%)
 Strand = Plus / Plus

                                                                       
Query: 202 ctctgagaggaatgagattcgtcttggtttgcctagtaaaggtcgcatggcttccgatac 261
           ||||||||| ||||| || ||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 213 ctctgagagaaatgaaatccgtctcggtttgcctagtaaaggccgcatggcttccgatac 272

                                                                       
Query: 262 tattgatcttctcaaggactgtcaactgtccgtcaagcaggtcaatcctcgacaatatgt 321
           | | ||||| |||||||| |||||| |||| ||||||||||||||||| |||||||||||
Sbjct: 273 tctcgatctcctcaaggattgtcaattgtctgtcaagcaggtcaatccacgacaatatgt 332

                       
Query: 322 tgcacaaattcc 333
           ||||||||||||
Sbjct: 333 tgcacaaattcc 344