Jatropha Genome Database
- JcCB0418081.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0418081.10 - phase: 0 /partial
(326 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29682.m000592 2-deoxyglucose-6-phosphate phosphatase, putative 94 6e-19
>29682.m000592 2-deoxyglucose-6-phosphate phosphatase, putative
Length = 1122
Score = 93.7 bits (47), Expect = 6e-19
Identities = 118/139 (84%), Gaps = 2/139 (1%)
Strand = Plus / Plus
Query: 96 tgctgtcattcttgatttggatggaacccttttggatacagagagtgctacaaagggtgt 155
|||||| || |||||||||||||| |||||| |||| ||||||| ||||||||| |||
Sbjct: 48 tgctgttatacttgatttggatggtacccttctggacacagagaatgctacaaaatatgt 107
Query: 156 tctgaaagaatttttggccaagtatgggaaagaactggacaaggaaaggg-aagaaagta 214
|||||||||||| ||||| || |||| |||||| |||| || ||||||| ||| ||| |
Sbjct: 108 tctgaaagaattcttggcaaaatatgagaaagatttggataaagaaagggaaagtaag-a 166
Query: 215 agaggttggggatgactct 233
||||||| |||||||||||
Sbjct: 167 agaggtttgggatgactct 185