Jatropha Genome Database

JcCB0417211.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0417211.10 - phase: 0 /pseudo/partial/short
         (103 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014485 conserved hypothetical protein                           98   1e-20
30190.m010913 conserved hypothetical protein                           54   1e-07

>30147.m014485 conserved hypothetical protein
          Length = 210

 Score = 97.6 bits (49), Expect = 1e-20
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggcagattggggtccagtgatagtagcagtggtgctgttcgtgctgttaacgccaggg 60
          |||||||||||||| ||||||||  |||||||| | ||||| |||||| |||||||||||
Sbjct: 1  atggcagattgggggccagtgatcatagcagtgattctgtttgtgctgctaacgccaggg 60

                           
Query: 61 ctgttgtttcagatacc 77
          |||||||||||||||||
Sbjct: 61 ctgttgtttcagatacc 77


>30190.m010913 conserved hypothetical protein
          Length = 210

 Score = 54.0 bits (27), Expect = 1e-07
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggcagattggggtccagtgatagtagcagtggtgctgttcgtgctgttaacgccaggg 60
          ||||| || ||||| |||||  || ||| ||||||||||||  ||||| ||||||| || 
Sbjct: 1  atggcggactgggggccagtattaataggagtggtgctgtttctgctgctaacgcctgga 60

                                 
Query: 61 ctgttgtttcagataccaggaaa 83
          || |||||||||||||| |||||
Sbjct: 61 cttttgtttcagatacctggaaa 83