Jatropha Genome Database

JcCB0415641.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0415641.10 - phase: 1 /partial
         (434 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30122.m000356 LysM domain GPI-anchored protein 2 precursor, puta...   113   9e-25

>30122.m000356 LysM domain GPI-anchored protein 2 precursor,
           putative
          Length = 1086

 Score =  113 bits (57), Expect = 9e-25
 Identities = 239/299 (79%), Gaps = 3/299 (1%)
 Strand = Plus / Plus

                                                                       
Query: 26  ctcaatagattatcctttgcttgtccctaatggcacttacttcttcactgccaacagttg 85
           |||| ||||||| ||||| ||||| ||||||||||||||    ||||||||||| |||||
Sbjct: 681 ctcattagattaccctttacttgttcctaatggcacttatgctttcactgccaatagttg 740

                                                                       
Query: 86  tgtgaaatgcaattgtgatgctgcaaacaactggacattacaatgtgagccatctggatt 145
            |||| |||||| |||||  ||||||||||||||| ||| ||||| |||||||||||  |
Sbjct: 741 cgtgagatgcaagtgtgactctgcaaacaactggatattgcaatgcgagccatctgggct 800

                                                                       
Query: 146 tagaccagcagccaagtcgacctggtcaacttgtccttccatgcgatgtgatggagcaac 205
           ||   ||  |||||| || || ||||| ||||||||| |||||  ||||||||| |||  
Sbjct: 801 ta---caatagccaactccacttggtctacttgtcctcccatgaaatgtgatggtgcaga 857

                                                                       
Query: 206 cagtttactccttagcaacaccacaactactggctgcaacacctcgacctgtgcctacgc 265
            | | ||  | || |||||| ||||| | | |||||||||||| | || |||||||| ||
Sbjct: 858 taatctatccattggcaacagcacaaatgcgggctgcaacaccaccacttgtgcctatgc 917

                                                                      
Query: 266 gggcttttccagccaaaatattttgacaacccttgccactgtatccacttgtccagcca 324
            || || || | |||||  ||  ||||| | ||||||||||||||||||||||||||||
Sbjct: 918 tgggttctctaaccaaacaatcctgacagcacttgccactgtatccacttgtccagcca 976