Jatropha Genome Database
- JcCB0398801.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0398801.10 + phase: 0
(519 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29598.m000460 Auxin-responsive protein IAA16, putative 159 2e-38
29883.m001993 Auxin-induced protein AUX28, putative 76 2e-13
29912.m005483 Auxin-responsive protein IAA27, putative 68 6e-11
29844.m003174 Auxin-responsive protein IAA7, putative 64 9e-10
30115.m001192 hypothetical protein 54 8e-07
29889.m003323 Flowering time control protein FCA, putative 52 3e-06
>29598.m000460 Auxin-responsive protein IAA16, putative
Length = 774
Score = 159 bits (80), Expect = 2e-38
Identities = 128/144 (88%)
Strand = Plus / Plus
Query: 374 ccggtagcagcagtgcagcttttgtgaaggttagcatggacggagctccatatttaagaa 433
|||| |||| |||||||||||| |||||||| ||||||||||| || |||||| ||||||
Sbjct: 401 ccggcagcaccagtgcagctttcgtgaaggtcagcatggacggtgcaccatatctaagaa 460
Query: 434 aagtggacttgaaattgtacaagagctaccaagaactctcagacgctctaggcaaaatgt 493
|||||||||| ||| | |||||||||||||||||||| || || || |||||||||||||
Sbjct: 461 aagtggacttaaaactatacaagagctaccaagaactttctgatgccctaggcaaaatgt 520
Query: 494 tcagctcctttacaattggtaatt 517
||||||||||||| ||||| ||||
Sbjct: 521 tcagctcctttaccattggaaatt 544
Score = 101 bits (51), Expect = 4e-21
Identities = 87/99 (87%)
Strand = Plus / Plus
Query: 233 cttcttctaatgatcctgcaaaaccaccagccaaagcacaggttgtgggttggccaccaa 292
|||||||||| ||||| ||||| |||||||| || ||||| |||||||||||||||||||
Sbjct: 242 cttcttctaacgatccagcaaagccaccagctaaggcacaagttgtgggttggccaccaa 301
Query: 293 ttcgatcattccgaaagaatgtcatgtctgtccagaaaa 331
|||| || ||||| || ||||| ||| ||||||||||||
Sbjct: 302 ttcgttcgttccggaaaaatgttatggctgtccagaaaa 340
>29883.m001993 Auxin-induced protein AUX28, putative
Length = 735
Score = 75.8 bits (38), Expect = 2e-13
Identities = 92/110 (83%)
Strand = Plus / Plus
Query: 394 tttgtgaaggttagcatggacggagctccatatttaagaaaagtggacttgaaattgtac 453
||||| ||||||||||||||||| || || ||| | ||||||||||| |||| |||||
Sbjct: 382 tttgtcaaggttagcatggacggggcaccttatctccgaaaagtggacctgaagatgtac 441
Query: 454 aagagctaccaagaactctcagacgctctaggcaaaatgttcagctcctt 503
||||||||||| || ||||| || || ||||| || |||||||| |||||
Sbjct: 442 aagagctaccaggagctctctgatgccctaggaaagatgttcagttcctt 491
Score = 69.9 bits (35), Expect = 1e-11
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 137 gaaagagaggattttcagaaactgtggatttaaagcttaatctttcgacgaaaga 191
||||||||||||| || |||||||||||||| |||||||||||||| |||||||
Sbjct: 131 gaaagagaggattctctgaaactgtggatttgaagcttaatctttcttcgaaaga 185
>29912.m005483 Auxin-responsive protein IAA27, putative
Length = 894
Score = 67.9 bits (34), Expect = 6e-11
Identities = 46/50 (92%)
Strand = Plus / Plus
Query: 263 ccaaagcacaggttgtgggttggccaccaattcgatcattccgaaagaat 312
|||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 416 ccaaggcacaagttgtgggatggccaccaattcgttcattccgaaagaat 465
>29844.m003174 Auxin-responsive protein IAA7, putative
Length = 546
Score = 63.9 bits (32), Expect = 9e-10
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 244 gatcctgcaaaaccaccagccaaagcacaggttgtgggttggccacca 291
|||||||| || ||||||||||| ||||| ||||||||||||||||||
Sbjct: 70 gatcctgccaagccaccagccaaggcacaagttgtgggttggccacca 117
>30115.m001192 hypothetical protein
Length = 7359
Score = 54.0 bits (27), Expect = 8e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 67 cctggaggtggaggtggaggtggaggt 93
|||||||||||||||||||||||||||
Sbjct: 133 cctggaggtggaggtggaggtggaggt 159
>29889.m003323 Flowering time control protein FCA, putative
Length = 2436
Score = 52.0 bits (26), Expect = 3e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 68 ctggaggtggaggtggaggtggaggt 93
||||||||||||||||||||||||||
Sbjct: 317 ctggaggtggaggtggaggtggaggt 342