Jatropha Genome Database

JcCB0398801.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0398801.10 + phase: 0 
         (519 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29598.m000460 Auxin-responsive protein IAA16, putative                159   2e-38
29883.m001993 Auxin-induced protein AUX28, putative                    76   2e-13
29912.m005483 Auxin-responsive protein IAA27, putative                 68   6e-11
29844.m003174 Auxin-responsive protein IAA7, putative                  64   9e-10
30115.m001192 hypothetical protein                                     54   8e-07
29889.m003323 Flowering time control protein FCA, putative             52   3e-06

>29598.m000460 Auxin-responsive protein IAA16, putative
          Length = 774

 Score =  159 bits (80), Expect = 2e-38
 Identities = 128/144 (88%)
 Strand = Plus / Plus

                                                                       
Query: 374 ccggtagcagcagtgcagcttttgtgaaggttagcatggacggagctccatatttaagaa 433
           |||| |||| |||||||||||| |||||||| ||||||||||| || |||||| ||||||
Sbjct: 401 ccggcagcaccagtgcagctttcgtgaaggtcagcatggacggtgcaccatatctaagaa 460

                                                                       
Query: 434 aagtggacttgaaattgtacaagagctaccaagaactctcagacgctctaggcaaaatgt 493
           |||||||||| ||| | |||||||||||||||||||| || || || |||||||||||||
Sbjct: 461 aagtggacttaaaactatacaagagctaccaagaactttctgatgccctaggcaaaatgt 520

                                   
Query: 494 tcagctcctttacaattggtaatt 517
           ||||||||||||| ||||| ||||
Sbjct: 521 tcagctcctttaccattggaaatt 544



 Score =  101 bits (51), Expect = 4e-21
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 233 cttcttctaatgatcctgcaaaaccaccagccaaagcacaggttgtgggttggccaccaa 292
           |||||||||| ||||| ||||| |||||||| || ||||| |||||||||||||||||||
Sbjct: 242 cttcttctaacgatccagcaaagccaccagctaaggcacaagttgtgggttggccaccaa 301

                                                  
Query: 293 ttcgatcattccgaaagaatgtcatgtctgtccagaaaa 331
           |||| || ||||| || ||||| ||| ||||||||||||
Sbjct: 302 ttcgttcgttccggaaaaatgttatggctgtccagaaaa 340


>29883.m001993 Auxin-induced protein AUX28, putative
          Length = 735

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 394 tttgtgaaggttagcatggacggagctccatatttaagaaaagtggacttgaaattgtac 453
           ||||| ||||||||||||||||| || || ||| |  ||||||||||| ||||  |||||
Sbjct: 382 tttgtcaaggttagcatggacggggcaccttatctccgaaaagtggacctgaagatgtac 441

                                                             
Query: 454 aagagctaccaagaactctcagacgctctaggcaaaatgttcagctcctt 503
           ||||||||||| || ||||| || || ||||| || |||||||| |||||
Sbjct: 442 aagagctaccaggagctctctgatgccctaggaaagatgttcagttcctt 491



 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 137 gaaagagaggattttcagaaactgtggatttaaagcttaatctttcgacgaaaga 191
           ||||||||||||| || |||||||||||||| ||||||||||||||  |||||||
Sbjct: 131 gaaagagaggattctctgaaactgtggatttgaagcttaatctttcttcgaaaga 185


>29912.m005483 Auxin-responsive protein IAA27, putative
          Length = 894

 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 263 ccaaagcacaggttgtgggttggccaccaattcgatcattccgaaagaat 312
           |||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 416 ccaaggcacaagttgtgggatggccaccaattcgttcattccgaaagaat 465


>29844.m003174 Auxin-responsive protein IAA7, putative
          Length = 546

 Score = 63.9 bits (32), Expect = 9e-10
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 244 gatcctgcaaaaccaccagccaaagcacaggttgtgggttggccacca 291
           |||||||| || ||||||||||| ||||| ||||||||||||||||||
Sbjct: 70  gatcctgccaagccaccagccaaggcacaagttgtgggttggccacca 117


>30115.m001192 hypothetical protein
          Length = 7359

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 67  cctggaggtggaggtggaggtggaggt 93
           |||||||||||||||||||||||||||
Sbjct: 133 cctggaggtggaggtggaggtggaggt 159


>29889.m003323 Flowering time control protein FCA, putative
          Length = 2436

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 68  ctggaggtggaggtggaggtggaggt 93
           ||||||||||||||||||||||||||
Sbjct: 317 ctggaggtggaggtggaggtggaggt 342