Jatropha Genome Database

JcCB0398461.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0398461.10 + phase: 0 
         (1155 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29642.m000276 conserved hypothetical protein                           60   3e-08
29630.m000832 ubiquitin-protein ligase, putative                       56   5e-07

>29642.m000276 conserved hypothetical protein
          Length = 1233

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 158 acccatgtcttatcttgcactatgacttgccaatccaaaaccatctctacactctccatt 217
           ||||||||||| |||||| || ||||||||| ||| ||| |||||||||| || | ||||
Sbjct: 224 acccatgtcttctcttgctctgtgacttgcccatcaaaagccatctctactctttgcatt 283

                 
Query: 218 tttctg 223
           ||||||
Sbjct: 284 tttctg 289


>29630.m000832 ubiquitin-protein ligase, putative
          Length = 1245

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 842 tttgggttatgaaagaatatggagtgcaggattcttggac 881
           ||||||| |||||||||||||||| | |||||||||||||
Sbjct: 845 tttgggtgatgaaagaatatggagcgaaggattcttggac 884