Jatropha Genome Database

JcCB0397941.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0397941.10 - phase: 0 
         (285 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30076.m004534 cytochrome P450, putative                                58   3e-08

>30076.m004534 cytochrome P450, putative
          Length = 1512

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 104/129 (80%)
 Strand = Plus / Plus

                                                                       
Query: 85  tggaaaccatatgccttgactagaagcttccgaagacaaggagtaagtgggccaccttac 144
           |||| ||||||||||||||||||||||||| ||   ||||| ||    || |||||||||
Sbjct: 88  tggagaccatatgccttgactagaagcttcagagagcaaggtgttgagggcccaccttac 147

                                                                       
Query: 145 tatctcttctctggatctctaaacgactggaaaaggttgaagatggatgccactcaaact 204
           |  ||||||   || |||||||||||   ||| ||||||||||||| ||| | |||||||
Sbjct: 148 ttgctcttcagaggttctctaaacgagctgaagaggttgaagatggctgcaaatcaaact 207

                    
Query: 205 gttttggat 213
           ||| |||||
Sbjct: 208 gttctggat 216