Jatropha Genome Database

JcCB0396891.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0396891.10 + phase: 1 /partial
         (593 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30075.m001164 Rhicadhesin receptor precursor, putative                100   2e-20
30075.m001165 Rhicadhesin receptor precursor, putative                 92   4e-18

>30075.m001164 Rhicadhesin receptor precursor, putative
          Length = 648

 Score = 99.6 bits (50), Expect = 2e-20
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                       
Query: 205 taaacactcttgggatctctttggctcgtgtagattttgcaccattgggtgttagctctc 264
           ||||||| |||||||| ||  |||||||||||||||||||||||| |||| ||| | |||
Sbjct: 257 taaacacacttgggatatccatggctcgtgtagattttgcaccatggggtattaaccctc 316

                                     
Query: 265 cacacatacatccaagggctactgaa 290
           |||||| |||||||||||||||||||
Sbjct: 317 cacacacacatccaagggctactgaa 342


>30075.m001165 Rhicadhesin receptor precursor, putative
          Length = 648

 Score = 91.7 bits (46), Expect = 4e-18
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 205 taaacactcttgggatctctttggctcgtgtagattttgcaccattgggtgttagctctc 264
           ||||||| |||||||| ||| |||||||| ||||||||||||||| |||| ||| | | |
Sbjct: 257 taaacacacttgggatatctatggctcgtatagattttgcaccatggggtattaacccac 316

                                     
Query: 265 cacacatacatccaagggctactgaa 290
           |||||| |||||||||||||||||||
Sbjct: 317 cacacacacatccaagggctactgaa 342



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 498 gcagtgtttggatcaaaccataatatttctagtgatattcttgccaagtcttttcaggtt 557
           ||||||||||||||| | | | | |||||||||||||||||||  ||| |||| || || 
Sbjct: 550 gcagtgtttggatcagatcctgacatttctagtgatattcttggaaaggctttccaagtg 609

                                               
Query: 558 gacgagaatgtcatttctcaaattcgagccaagttc 593
           |||  |||||| |||| |||||| | ||||||||||
Sbjct: 610 gacaggaatgtaatttatcaaatgcaagccaagttc 645