Jatropha Genome Database

JcCB0395701.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0395701.10 + phase: 0 /pseudo/partial
         (258 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29620.m000548 Lipid-A-disaccharide synthase, putative                 123   5e-28

>29620.m000548 Lipid-A-disaccharide synthase, putative
          Length = 1410

 Score =  123 bits (62), Expect = 5e-28
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 140 ttgctggtgaggtttcaggagatactattggttctcgtcttatggcttccttgaagaagc 199
           ||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||| |
Sbjct: 152 ttgctggcgaggtttcaggtgattctattggttctcgtcttatggcttccttgaagaacc 211

                                                 
Query: 200 tttctcctactcccatccgctttgcaggcgttggaggg 237
           | ||||||||||| || |||||||| || |||||||||
Sbjct: 212 tctctcctactcctattcgctttgctggtgttggaggg 249