Jatropha Genome Database

JcCB0392311.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0392311.10 + phase: 0 
         (432 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29693.m001989 conserved hypothetical protein                           94   8e-19

>29693.m001989 conserved hypothetical protein
          Length = 420

 Score = 93.7 bits (47), Expect = 8e-19
 Identities = 56/59 (94%)
 Strand = Plus / Plus

                                                                      
Query: 149 taactattttctacaatggcaacatttgcgtttgtgatgttacagagttacaggctaga 207
           ||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||
Sbjct: 134 taactattttctacaatggcaacgtttgcgtttgtgatgttacagattttcaggctaga 192



 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                   
Query: 1  atgaggagaaactgcaatcttgaactccgtttgtttccgttccccgattccgatgac 57
          |||||| ||||||||||||||||||||||  | ||||| ||| ||||| ||||||||
Sbjct: 1  atgaggcgaaactgcaatcttgaactccgcctttttcccttctccgatcccgatgac 57