Jatropha Genome Database

JcCB0379541.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0379541.10 - phase: 1 /partial
         (347 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29948.m000687 similarity to receptor protein kinase, putative         133   8e-31
29842.m003541 similarity to receptor protein kinase, putative          62   2e-09

>29948.m000687 similarity to receptor protein kinase, putative
          Length = 1812

 Score =  133 bits (67), Expect = 8e-31
 Identities = 88/95 (92%)
 Strand = Plus / Plus

                                                                       
Query: 253 aagaacttgcccaggctactgataacttcaatgtggctaataagattggcaaaggtgggt 312
           |||||||||||| ||||||||||||||||| | ||||||||||||||||| ||||||| |
Sbjct: 887 aagaacttgccctggctactgataacttcagtttggctaataagattggccaaggtggct 946

                                              
Query: 313 ttgggtctgtctactatgcagaactgagaggcgag 347
           |||||||||| |||||||||||||| |||||||||
Sbjct: 947 ttgggtctgtatactatgcagaacttagaggcgag 981


>29842.m003541 similarity to receptor protein kinase, putative
          Length = 1824

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 237 gtggagttctcatacaaagaacttgcccaggctactgataacttcaatgtggctaataag 296
           ||||||||||||||  ||||||||||  | |||||| || ||||||   ||| |||||| 
Sbjct: 883 gtggagttctcatatgaagaacttgctaatgctactaatgacttcagcatggttaataaa 942

                                                              
Query: 297 attggcaaaggtgggtttgggtctgtctactatgcagaactgagaggcgag 347
           |||||  |||| || ||||| || ||||||||||| ||||| |||||||||
Sbjct: 943 attgggcaaggaggctttggatcagtctactatgctgaactaagaggcgag 993