Jatropha Genome Database
- JcCB0375071.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0375071.10 + phase: 2 /partial
(337 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30147.m014078 similarity to nuclear protein zap, putative 385 e-106
>30147.m014078 similarity to nuclear protein zap, putative
Length = 2031
Score = 385 bits (194), Expect = e-106
Identities = 242/258 (93%)
Strand = Plus / Plus
Query: 56 gtggatgaccgcaatctgcgggtagctgattttgctcagttttgggcaattgcgaagaga 115
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1204 gtggatgaccgcaatctgcgggtagctgattttgctcagttttgggcaattgcaaagaga 1263
Query: 116 tccggctatgaggtttacatatcagaagctacatataaagaccctgtgggctgtgcagct 175
|| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 1264 tctggctatgaagtttacatatcagaagctacatataaagaccctgcgggctgtgcagct 1323
Query: 176 aggaatgtacatggtttcactctagatgaaataaaaagcatggctgagcagtgggaggaa 235
|||||||| |||||||| || ||||||||||||||||||||||||| ||||||||| |||
Sbjct: 1324 aggaatgtccatggttttaccctagatgaaataaaaagcatggctgggcagtgggaagaa 1383
Query: 236 gctccagtattgtacttgcaactggacatcaagtcattattccacggggatgacctgaag 295
|||||| ||| || ||||||||||| |||||||| |||||||| |||||||||||||||
Sbjct: 1384 gctccaacattatatttgcaactggatatcaagtcgttattccatggggatgacctgaag 1443
Query: 296 gaaagtggaattcaagag 313
||||||||||||||||||
Sbjct: 1444 gaaagtggaattcaagag 1461