Jatropha Genome Database

JcCB0374621.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0374621.10 - phase: 1 /pseudo/partial
         (1023 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29822.m003359 serine-threonine protein kinase, plant-type, putative    86   5e-16

>29822.m003359 serine-threonine protein kinase, plant-type, putative
          Length = 1818

 Score = 85.7 bits (43), Expect = 5e-16
 Identities = 280/359 (77%)
 Strand = Plus / Plus

                                                                       
Query: 180 tgcagccttgatttgccatcttctttgcctgattataataactcaagttgcacagaggga 239
           |||| |||||||||| ||| ||| || ||||||||| |   ||| | ||| | ||| |||
Sbjct: 127 tgcacccttgatttgtcattttcattacctgattattacgtctccaattgtatagaagga 186

                                                                       
Query: 240 gattggggcggattcctatcgaaaaattgttgtgggtcagcttttcattcctaccttcat 299
           |||||||| || |||||||| |||||||| || || ||| | |||||| ||||||| |||
Sbjct: 187 gattggggtgggttcctatcaaaaaattgctgcggatcaacatttcatgcctacctccat 246

                                                                       
Query: 300 gcagtggggcggagggctaatcgaacgggacttatatacctgaattccactgagcaaagc 359
            |  |||| ||||| || ||||| || ||  ||||||||||  ||||   ||||||||| 
Sbjct: 247 tcgctgggccggagagcgaatcgtacaggttttatatacctagattctgatgagcaaagg 306

                                                                       
Query: 360 agttgcctggctgaaatggaaaaatctgaagcagatgtctttagttgtgggattgacaag 419
           |||||  | | ||| ||||  |||| |||||| || |  || ||||||||||||||||||
Sbjct: 307 agttgtttagatgagatggggaaatatgaagctgaagatttcagttgtgggattgacaag 366

                                                                       
Query: 420 ctgacaagtgggttgggagggtgttctgatttctctgttgccaatgttagtcataggctg 479
           ||||| |||||    ||||| |||||||| || ||||||||||| |||| || |||  ||
Sbjct: 367 ctgacgagtggaggtggaggctgttctgacttttctgttgccaacgttactcgtagattg 426

                                                                      
Query: 480 gggaaggaactgaaaagtttgtctgaaaattgcaaatttgatggttctgataaagaatc 538
           ||   | |||||||||| ||| | ||||| || || || || | |||||||||||||||
Sbjct: 427 ggagggaaactgaaaagattgacagaaaactgtaagttcgaggattctgataaagaatc 485



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 990  aatctaagtgaaaagaatctcattggtgaaggaa 1023
            |||||||||||  |||||||||||||||||||||
Sbjct: 940  aatctaagtgacgagaatctcattggtgaaggaa 973