Jatropha Genome Database

JcCB0369541.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0369541.10 + phase: 0 /pseudo/partial
         (256 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013829 conserved hypothetical protein                          236   5e-62
29883.m002045 conserved hypothetical protein                           72   2e-12

>30170.m013829 conserved hypothetical protein
          Length = 1110

 Score =  236 bits (119), Expect = 5e-62
 Identities = 189/211 (89%), Gaps = 1/211 (0%)
 Strand = Plus / Plus

                                                                       
Query: 8   gtggacttcccatgcttaactgcctgttacagcacaccttgagaagcctttgtacatgtt 67
           ||||| |||||||||||||||| || |||||||||||  | |||||||||||||| || |
Sbjct: 8   gtggatttcccatgcttaactgtctattacagcacacactaagaagcctttgtacgtgct 67

                                                                       
Query: 68  cagattcttctaattcttccaaatgggtttatgcagtcttttggaggatacttcctagaa 127
           ||||||||||||| | ||| |||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 68  cagattcttctaaattttctaaatgggtttatgcagtcttttggagaatactgcctagga 127

                                                                       
Query: 128 attaccctccaccaaaatgggattatggaggcactgcccttgatcgatccaaagg-aaca 186
           |||| ||||| ||||| |||||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 128 attatcctcctccaaagtgggattacggaggcactgcccttgatcgttccaaaggaaaca 187

                                          
Query: 187 aaagaaactggatccttgtttgggaagatgg 217
           ||||||||||||| ||||||||||| |||||
Sbjct: 188 aaagaaactggattcttgtttgggaggatgg 218


>29883.m002045 conserved hypothetical protein
          Length = 1101

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 91  tgggtttatgcagtcttttggaggatacttcctagaaattaccctccaccaaaatgggat 150
           ||||||||||| ||||| ||||||||  | |||||||||||||||||||| |||||||||
Sbjct: 85  tgggtttatgctgtcttctggaggatcttgcctagaaattaccctccacccaaatgggat 144