Jatropha Genome Database

JcCB0368291.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0368291.10 - phase: 0 /pseudo/partial/short
         (141 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014289 tetracycline transporter, putative                       56   5e-08

>30170.m014289 tetracycline transporter, putative
          Length = 1329

 Score = 56.0 bits (28), Expect = 5e-08
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 41  tctttctttataacttctcaactttcatggtgactccggccatgactgatgttactatgt 100
           |||||||  |||||||||| || || ||||||| ||| ||||| || || ||||| ||||
Sbjct: 41  tctttctgcataacttctccacgtttatggtgattcctgccatcaccgacgttacgatgt 100

                           
Query: 101 ctgcactttgtcctgg 116
           |||| |||||||||||
Sbjct: 101 ctgcgctttgtcctgg 116