Jatropha Genome Database

JcCB0359161.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0359161.10 + phase: 0 /pseudo/partial
         (1666 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29726.m003973 t12h1.7 protein, putative                               141   2e-32
29726.m003974 hypothetical protein                                     58   2e-07

>29726.m003973 t12h1.7 protein, putative
          Length = 990

 Score =  141 bits (71), Expect = 2e-32
 Identities = 166/197 (84%), Gaps = 3/197 (1%)
 Strand = Plus / Plus

                                                                       
Query: 647 gcaaggttaagggctatgtgagtcttttttgtcgaatcagcaaggaaggaaaagacaaat 706
           ||||||| ||||||| |||||||||||||||||  || || |||||||| ||||||| ||
Sbjct: 242 gcaaggtgaagggctttgtgagtcttttttgtcatattagaaaggaagggaaagacacat 301

                                                                       
Query: 707 ttcaaattccaccaggtgaactattccgcttctctcatatgattccatcatttaaattga 766
           ||| |||||||||   |||||| ||||||||||| || ||||||||||  |||||||| |
Sbjct: 302 ttctaattccacccactgaactcttccgcttctcccacatgattccattgtttaaattca 361

                                                                       
Query: 767 cgggtgaggaaagacaaggtgtaccaaggggatcttttgaactcgatcctgcttctttgc 826
           | || |  |||||   |||||| |||| |||||||||  |||||||||| ||||||||||
Sbjct: 362 caggggcagaaag---aggtgtgccaaagggatctttcaaactcgatccagcttctttgc 418

                            
Query: 827 ccaaaaatattgaagag 843
           ||||| |||||||||||
Sbjct: 419 ccaaagatattgaagag 435



 Score = 65.9 bits (33), Expect = 7e-10
 Identities = 58/65 (89%), Gaps = 1/65 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1042 gaagatattgaaattccagaaccagaattcttcaactttgatgctgagaaatccattgaa 1101
            |||| |||||||||| ||||||||||||||| |   || |||||||||||||||||||||
Sbjct: 538  gaagctattgaaatttcagaaccagaattct-ctttttcgatgctgagaaatccattgaa 596

                 
Query: 1102 aagtt 1106
            |||||
Sbjct: 597  aagtt 601



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1612 gagctgcttagattctcacatcagattcctgcttttcgactaacaga 1658
            ||||||||||||||||| ||||||||||||  ||||| | |||||||
Sbjct: 763  gagctgcttagattctcccatcagattcctatttttcaattaacaga 809


>29726.m003974 hypothetical protein
          Length = 792

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 177 agatttcaatgactttgacaaaggccggaatga 209
           ||||||||||||||||||||||| |||||||||
Sbjct: 747 agatttcaatgactttgacaaagtccggaatga 779