Jatropha Genome Database
- JcCB0359061.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0359061.20 - phase: 0
(396 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29869.m001150 conserved hypothetical protein 54 6e-07
>29869.m001150 conserved hypothetical protein
Length = 390
Score = 54.0 bits (27), Expect = 6e-07
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 280 gaacaacggttaaatcttttgcgtagaaagcaccttttgagag 322
|||||| |||||||||||||| | ||||||||||||| |||||
Sbjct: 277 gaacaaaggttaaatcttttgtggagaaagcacctttcgagag 319
Score = 52.0 bits (26), Expect = 3e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 357 ttggattcctgcactacaaagcattcctgaggag 390
|||| |||||||||| ||||||||||||||||||
Sbjct: 351 ttgggttcctgcacttcaaagcattcctgaggag 384